Hosuk:LabNotes/2013-8-5: Difference between revisions
Jump to navigation
Jump to search
>Hosuki78 No edit summary |
>Hosuki78 No edit summary |
||
Line 33: | Line 33: | ||
*Circ. reaction lane has no band near 90bp, it seemed circularized. | *Circ. reaction lane has no band near 90bp, it seemed circularized. | ||
[[File:CircLigaseII_20uL_Gel.png| | [[File:CircLigaseII_20uL_Gel.png|250px]] | ||
Revision as of 00:23, 6 August 2013
Test Decoding probes using custom pre-circularized oligos
Previous try
- Alan and I have tried decoding pre-circularized oligos made from Matt at 07/30/2013.
- I added oligos in fixed cells on MatTek glass-bottom dish, and ran RCA to generate rolonies.
- However the signal wasn’t seen any FL signal after hybridizing decoding probes.
- We suspected that the amount of oligos might not enough (The actual concentration or amount of the oligos was unknown).
- So I've ordered 90bp ssDNA from IDT which has 3 sites for decoding probes and 1 site for RCA probes.
2nd try with 90bp custom oligo
=Template design
- Sequence : /5Phos/CCCGATATCCGACGGTAGTGTGTCTTGCGTGCGATACGGAGTATCTACTTCGTCGCGTCAGACCATCGGAATACGTCGTTGACTGCGTTC
- RCA probe sequence : ACACTACCGTCGGATATC
- Decoding probes for this experiment
- dcProbe1-Cy3 : Cy3-GTCTTGCGTGCGATACGGAGTA
- dcProbe2-Cy3 : Cy3-TCTACTTCGTCGCGTCAGACCA
- dcProbe4-FAM : FAM-TCGGAATACGTCGTTGACTGCG
File:Sequence Template Probes.png
=Circularization
- CircLigase II reaction with 50pmole input DNA
- 6 hr reaction
- Circ. reaction lane has no band near 90bp, it seemed circularized.
File:CircLigaseII 20uL Gel.png
- Start at 06/29
- Use cell dishes fixed at 07/07 --> Cells were not plenty… need to thaw new one
- GC, lysine coated dish
- Run RT : 5:00pm 07/07 ~ 9:00am 07/08 --> ~15hr.
- Run CircLigase II : S1 --> 1:30pm 07/08 ~ 3:30pm 07/08 --> 2hr.
- Run CircLigase II : S2 --> 11:30am 07/08 ~ 3:30pm 07/08 --> 4hr.
- Run RCA : 4:30 pm 07/08 ~ 12:30pm 07/09 --> ~20hr.