Daniel:Notebook/RNAFISH/2014-7-7: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Djacobse
No edit summary
>Djacobse
No edit summary
Line 19: Line 19:
##VI command, reverse: :g/$/norm AGATCAGGATACACACTACCC
##VI command, reverse: :g/$/norm AGATCAGGATACACACTACCC
##Primer sequences are AP1 and AP2 from the V6 set, used in High Resolution Chromosome Painting
##Primer sequences are AP1 and AP2 from the V6 set, used in High Resolution Chromosome Painting
==Price Comparison IDT and Stellaris==
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8</hiddentext>
|- style="background-color:#C5D9F1;font-size:12pt"
| align="center" width="141" height="30"  valign="bottom" | &nbsp;
|style="font-weight:bold" width="56" align="center" valign="bottom" | IDT Primers
|style="font-weight:bold" width="83" align="center" valign="bottom" | IDT Fluorophores
|style="font-weight:bold" width="65" align="center" valign="bottom" | Stellaris
|- style="font-size:12pt"
| height="15"  valign="bottom" | Length
| align="center" align="center" valign="bottom" | 58
| align="center" align="center" valign="bottom" | 20
| align="center" align="center" valign="bottom" | 20
|- style="background-color:#D9D9D9;font-size:12pt"
| height="15"  valign="bottom" | Number of Oligos
| align="center" align="center" valign="bottom" | 93
| align="center" align="center" valign="bottom" | 93
| align="center" align="center" valign="bottom" | 93
|- style="font-size:12pt"
| height="15"  valign="bottom" | Price/Base (100 nmol, USD)
| align="center" align="center" valign="bottom" | 0.28
| align="center" align="center" valign="bottom" | 0.28
| align="center" valign="bottom" | NA
|- style="background-color:#D9D9D9;font-size:12pt"
| height="15"  valign="bottom" | Modifications
| align="center" valign="bottom" | None
| align="center" valign="bottom" | Fluorophore
| align="center" valign="bottom" | Fluorophore
|- style="font-size:12pt"
| height="15"  valign="bottom" | Oligo Price
| align="center" align="center" valign="bottom" | 1510.32
| align="center" align="center" valign="bottom" | 520.8
| align="center" align="center" valign="bottom" | 1725
|- style="background-color:#D9D9D9;font-size:12pt"
| height="15"  valign="bottom" | Modifications
| align="center" align="center" valign="bottom" | 0
| align="center" align="center" valign="bottom" | 85
| align="center" align="center" valign="bottom" | 0
|- style="font-size:12pt"
| height="15"  valign="bottom" | Total Price
|style="font-weight:bold" align="center" align="center" valign="bottom" | 1510.32
|style="font-weight:bold" align="center" align="center" valign="bottom" | 44268
|style="font-weight:bold" align="center" align="center" valign="bottom" | 1725
|}
It would appear Stellaris can do this pretty cheap.

Revision as of 22:24, 7 July 2014

Probe Design

Back to Calendar

Designing probes for Matt and Hosuk's rolony project. The three genes they are testing are ACTB, RAB7A, and MALAT1. I will design probe sets for these three genes.

Workflow

  1. Obtain transcript sequence from Genome Browser
    1. Use genome browser to find genes, and tables to download transcript (mRNA only)
  2. Use gene sequence as input for probe designer
    1. Designer created by Arjun Raj, utilized by Long Cai for paper
    2. Creates 20mer probes
  3. Copy/paste probe sequences into .txt file
  4. Print only sequence to the oligo file
    1. awk '{print $2}' malat1_probes.txt > oligos_malat1.txt
  5. Attach primer sequences before/after
    1. VI command, forward: :%s!^!GTCATATCGGTCACTGTT!
    2. VI command, reverse: :g/$/norm AGATCAGGATACACACTACCC
    3. Primer sequences are AP1 and AP2 from the V6 set, used in High Resolution Chromosome Painting

Price Comparison IDT and Stellaris

  IDT Primers IDT Fluorophores Stellaris
Length 58 20 20
Number of Oligos 93 93 93
Price/Base (100 nmol, USD) 0.28 0.28 NA
Modifications None Fluorophore Fluorophore
Oligo Price 1510.32 520.8 1725
Modifications 0 85 0
Total Price 1510.32 44268 1725

It would appear Stellaris can do this pretty cheap.