Sam:LabNotes/Microbione/2009-2-3: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Sam Chiang
>Sam Chiang
Line 35: Line 35:


==Bacteria S16 primer==
==Bacteria S16 primer==
#Use the reported 16S primers which has been tested on conserved region of 16S gene[[Media:(citation of 16S primer.doc)]].
#Use the reported 16S primers which has been tested on conserved region of 16S gene[[Media:Soni_E coli 0157 and AI-2_2008.PDF| (ciataiton of 16S primer)]].
#Primer sequences have been test on '''UCSD prokaryote genome browser'''[http://archaea.ucsc.edu/cgi-bin/hgGateway?org=Salmonella+typhimurium+LT2&db=salmTyph_LT2&hgsid=182679]. All of primers were able to match most E. coli stains' 16S gene region.
#Primer sequences have been test on '''UCSD prokaryote genome browser'''[http://archaea.ucsc.edu/cgi-bin/hgGateway?org=Salmonella+typhimurium+LT2&db=salmTyph_LT2&hgsid=182679]. All of primers were able to match most E. coli stains' 16S gene region.



Revision as of 18:34, 9 February 2009

Primer design for human 18S and Bacteria 16S

Objective

Beside the realtime monitoring,

  1. Design 18S primers for positive control / validation purpose of a successful MDA reaction using human genome template.
  2. Design 16S primers for positive control / validation purpose of a successful MDA reaction using bacteria genome template.
  3. These primers could also be used to detect the contamination of exogenus gDNA.

Human S18 primer

  1. Collect the human S18 cDNA sequence
  2. Clean the sequcne and mask the inconsistat nucleotide
  3. Paste the sequence on KZ's Primer3 calculator[1]
  4. Criteria:
    Primer size: Min: 18bp, opt:20 bp, Max: 22bp
    Product size: ~200 bp; ~300 bp
    Annealing Temp: Min:57, Opt:58, Max:59

Results

  1. Using Netprimer[2]to evaluate primer structure.
  2. Pick up two primers with differnt size of amplicon.
    >h18S_211_f                  
    TTGCTGCAGTTAAAAAGCTC        
    >h18S_211_r
    CATTATTCCTAGCTGCGGTA
    -----------------------------------------------
    >h18S_306_f
    GTACAGTGAAACTGCGAATG
    >h18S_306_r
    CGACTACCATCGAAAGTTGA
    -----------------------------------------------


Bacteria S16 primer

  1. Use the reported 16S primers which has been tested on conserved region of 16S gene (ciataiton of 16S primer).
  2. Primer sequences have been test on UCSD prokaryote genome browser[3]. All of primers were able to match most E. coli stains' 16S gene region.


Primer sequences

   >Pilli_16S_f
   CCAGCAGCCGCGGTAAT
   >Pilli_16S_r
   TGCGCTTTACGCCCAGTAAT
   ----------------------------------------------
   >Dowd_16S-1-f
   TCCTACGGGAGGCAGCAGT
   >Dowd_16S-1-r
   GGACTACCAGGGTATCTAATCCTGTT
   ----------------------------------------------
   >Dowd_16S-2-f
   CGCTAGTAATCGTGGATCAGAATG
   >Dowd_16S-2-r
   TGTGACGGGCGGTGTGTA