Sam:LabNotes/Microbione/2009-2-3: Difference between revisions
Jump to navigation
Jump to search
>Sam Chiang |
>Sam Chiang |
||
Line 35: | Line 35: | ||
==Bacteria S16 primer== | ==Bacteria S16 primer== | ||
#Use the reported 16S primers which has been tested on conserved region of 16S gene[[Media:( | #Use the reported 16S primers which has been tested on conserved region of 16S gene[[Media:Soni_E coli 0157 and AI-2_2008.PDF| (ciataiton of 16S primer)]]. | ||
#Primer sequences have been test on '''UCSD prokaryote genome browser'''[http://archaea.ucsc.edu/cgi-bin/hgGateway?org=Salmonella+typhimurium+LT2&db=salmTyph_LT2&hgsid=182679]. All of primers were able to match most E. coli stains' 16S gene region. | #Primer sequences have been test on '''UCSD prokaryote genome browser'''[http://archaea.ucsc.edu/cgi-bin/hgGateway?org=Salmonella+typhimurium+LT2&db=salmTyph_LT2&hgsid=182679]. All of primers were able to match most E. coli stains' 16S gene region. | ||
Revision as of 18:34, 9 February 2009
Primer design for human 18S and Bacteria 16S
Objective
Beside the realtime monitoring,
- Design 18S primers for positive control / validation purpose of a successful MDA reaction using human genome template.
- Design 16S primers for positive control / validation purpose of a successful MDA reaction using bacteria genome template.
- These primers could also be used to detect the contamination of exogenus gDNA.
Human S18 primer
- Collect the human S18 cDNA sequence
- Clean the sequcne and mask the inconsistat nucleotide
- Paste the sequence on KZ's Primer3 calculator[1]
- Criteria:
Primer size: Min: 18bp, opt:20 bp, Max: 22bp Product size: ~200 bp; ~300 bp Annealing Temp: Min:57, Opt:58, Max:59
Results
- Using Netprimer[2]to evaluate primer structure.
- Pick up two primers with differnt size of amplicon.
>h18S_211_f TTGCTGCAGTTAAAAAGCTC >h18S_211_r CATTATTCCTAGCTGCGGTA ----------------------------------------------- >h18S_306_f GTACAGTGAAACTGCGAATG >h18S_306_r CGACTACCATCGAAAGTTGA -----------------------------------------------
Bacteria S16 primer
- Use the reported 16S primers which has been tested on conserved region of 16S gene (ciataiton of 16S primer).
- Primer sequences have been test on UCSD prokaryote genome browser[3]. All of primers were able to match most E. coli stains' 16S gene region.
Primer sequences
>Pilli_16S_f CCAGCAGCCGCGGTAAT >Pilli_16S_r TGCGCTTTACGCCCAGTAAT ---------------------------------------------- >Dowd_16S-1-f TCCTACGGGAGGCAGCAGT >Dowd_16S-1-r GGACTACCAGGGTATCTAATCCTGTT ---------------------------------------------- >Dowd_16S-2-f CGCTAGTAATCGTGGATCAGAATG >Dowd_16S-2-r TGTGACGGGCGGTGTGTA