Noi/NOTES/2014-10-15: Difference between revisions
Jump to navigation
Jump to search
>Noi mNo edit summary |
>Noi mNo edit summary |
||
Line 44: | Line 44: | ||
* From the gel image, there is a smear below 100bp band in all the three subsets, which is unexpected. The amplicons size should be ~125-130bp. The sizeof positive control are correct. I am pretty sure that I added the right reagents in each reaction. In addition, the result of expansion PCR in large volume of LMS_selector and padlock_SNP were consistent with the quick test PCR. | * From the gel image, there is a smear below 100bp band in all the three subsets, which is unexpected. The amplicons size should be ~125-130bp. The sizeof positive control are correct. I am pretty sure that I added the right reagents in each reaction. In addition, the result of expansion PCR in large volume of LMS_selector and padlock_SNP were consistent with the quick test PCR. | ||
* I will check the result with Chris for his probe set to see if he has the same issue. | * I will check the result with Chris for his probe set to see if he has the same issue. | ||
[[Chris:LabNotes/FateMapping/Calendar/2014/2014-10-16| '''Chris's result''']]<br> | ** [[Chris:LabNotes/FateMapping/Calendar/2014/2014-10-16| '''Chris's result''']]<br> | ||
* From Chis's result, he got the similar smear below 100bp like the other three subsets amplified by me. | * From Chis's result, he got the similar smear below 100bp like the other three subsets amplified by me. | ||
* I double-check the primer/adaptor sequences of the designed probes. The design sounds to be right for the four subset and the number of each subset agrees with Dr. Zhang's note. | * I double-check the primer/adaptor sequences of the designed probes. The design sounds to be right for the four subset and the number of each subset agrees with Dr. Zhang's note. | ||
** [[ | ** [[File:2014-10-16-90k-sep14-primer-check.doc| '''Primer/adaptor sequence check''']] | ||
* Dr. Zhang notes that CustomArray has start to synthesize the new batch of these probe sets. | * Dr. Zhang notes that CustomArray has start to synthesize the new batch of these probe sets. |
Revision as of 19:38, 17 October 2014
- Link to calendar
- 2014-10-15: Received :90k_oligos_30Sept2014 from CustomArray
Oligo info.
- Name: 90k_oligos_30Sept2014
- Conc. 69.89ng/ul,
- Volume 80ul in TE buffer. Total amount XXug
- Info from Dr. Zhang's note
*Sept14 probe set: Media:90k_oligos_30Sept2014.txt.gz probe set # probes Length Amp primers Chris gDNA_MS_v2 8,045 127bp V6(G*T*CATATCGGTCACTGTU//5Phos/GGGTAGTGTGTATCCTG) Kun cancer_hyb_sept14 51,639 110-130bp V8(T*C*TAATCTAGCGCGACGTCU//5Phos/CCACAAGAGGCGCTATG) Kun LMS_selector 17,342 124-130bp NE(TGCCTAGGACCGGATCAACT/GCTTCGGTTCACGCAATG) Kun padlock_SNPs 12,974 125bp V4(G*A*CTGGAAGAGCACTGTU//5Phos/AGCCTCATGCGTATCCG) Total 90,000
- Length: I would use the average size of the oligo pool to calculate concentration ~125nt = MW=41250g/mole
- Conc. : 69.89 ng/ul = 1694.30 (69.89ng/ul/ 41250g/mole)
Expansion PCR (Quick test, round1)
- I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set)
- I will include the two positive control for the two primer set to confirm that the amplification works fine. Note that I combine F & R primer in final conc. 10uM in the same tube.
Components Volume (ul) Final conc. Seed oligo (1694.3nM) 0.59 100nM F/R primer mix (10uM) 0.40 400nM 2x KAPA SYBG fast MM 5.00 1x H2O 4.01 Total 10.00
- 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 18-> 72C 3min -> 15C hold
- The qPCR curves of all reactions showed amplification very well ~16 cycles for the new probe set. I then continued to do expansion PCR in larger volume (150ul, 100uM of the template for each subset) without gel verification
Components Volume (ul) Seed oligo (1694.3nM) 8.85 F primer mix (10uM) 0.60 R primer mix (10uM) 0.60 2x KAPA SYBG fast MM 75.00 H2O 64.95 Total 150.00
- Split each set in 3X50ul
- 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 16-> 72C 3min -> 15C hold
- Purify the 1st amplicons with 2x QIAquick column and elute with 50ul TE buffer
- Measure concentration by N.D.
- Will add N.D. result.
- I then continue to amplify cancer_hyb_sep14 probe set with the same condition of the quick test for the two subsets above for 16 cycles. The amplification worked fine at 16 cycles.
- I ran all 1st round amplicon in 6% TBE gel
- For quick test PCR product, I added 2ul of 6X loading dye to 10ul of PCR product and loaded 3ul in the gel. For column purified amplicons, I loaded 1ul for each
File:ZhangLab 2 2014-10-16 14hr 04min test ExpPCR Verify.jpg
- From the gel image, there is a smear below 100bp band in all the three subsets, which is unexpected. The amplicons size should be ~125-130bp. The sizeof positive control are correct. I am pretty sure that I added the right reagents in each reaction. In addition, the result of expansion PCR in large volume of LMS_selector and padlock_SNP were consistent with the quick test PCR.
- I will check the result with Chris for his probe set to see if he has the same issue.
- From Chis's result, he got the similar smear below 100bp like the other three subsets amplified by me.
- I double-check the primer/adaptor sequences of the designed probes. The design sounds to be right for the four subset and the number of each subset agrees with Dr. Zhang's note.
- Dr. Zhang notes that CustomArray has start to synthesize the new batch of these probe sets.