Matt:LabNotes/2016-3-31: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
>Mzcai
Line 24: Line 24:


==Measure DNA Concentration==
==Measure DNA Concentration==
*Use Qubit ssDNA kit to measure amount of ssDNA on beads
**Assume free biotin-oligos have been all washed away
**Measure only streptavidin bead as well for base-line
*Beads + DNA: 1.56ng/ul
*Beads only: 164pg/ul
*Don't trust the quantitation but it shows ssDNA was bound to beads


==Capture with CA12kNov2014 V4 in tube==
==Capture with CA12kNov2014 V4 in tube==

Revision as of 19:38, 8 April 2016

Bead with PKP2 Target for DARTFISH Positive Control=

  • Using PA gel may prevent diffusion of probes and enzymes during DARTFISH
  • To test this and to have a positive control for future experiments need to design a synthetic target
    • Attach target to magnetic streptavidin bead
  • Design oligonucleotide with biotin 5' modification
    • Chose PKP2 gene because haven't detected it in any DARTFISH samples
    • Also this specific padlock probe has very high efficiency when measured in tube
 PKP2_control	/5BiosG/AAAAAAGAGATGGCTGTCTTTTTCACACTTGGGTCACCAACATGCAGCATCTTTC

Link PKP2_control oligo to Streptavidin Bead

  1. Make 2X B&W (Binding and Wash) Buffer
    • 16ml 5uM NaCl + 80ul 5uM EDTA + 100ul 4uM Tris-HCl + 23.82ml H2O
  2. Resuspend beads by vortexing
  3. Transfer 100ul of beads (10ug/ul) to new tube
  4. Pull down by magnet 2min and remove supernatant
  5. Wash 3x with 100ul 1X B&W Buffer by resuspending and then removing supernatant
  6. Resuspend in 200ul 2X B&W Buffer
  7. Add 200ul of 2.5uM PKP2_Control
  8. Incubate 15min at RT gently rotating
  9. Pull down with magnet
  10. Wash 3x with 1X B&W Buffer
  11. Resuspend in 1ml 1X PBS

Measure DNA Concentration

  • Use Qubit ssDNA kit to measure amount of ssDNA on beads
    • Assume free biotin-oligos have been all washed away
    • Measure only streptavidin bead as well for base-line
  • Beads + DNA: 1.56ng/ul
  • Beads only: 164pg/ul
  • Don't trust the quantitation but it shows ssDNA was bound to beads

Capture with CA12kNov2014 V4 in tube

Reference protocol

PCR + Sequencing Adapters