Matt:LabNotes/2016-9-9: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
>Mzcai
Line 143: Line 143:
*Incubate at 37C for 15min
*Incubate at 37C for 15min
*94C for 2min
*94C for 2min
*Enzyme digest template 37C for 1 hr
*Aliquot 10ul from each into separate strip of tubes and put at 4C for 1 hr until qPCR
**2ul Exo I/III (1:1) for DNA
*Enzyme digest template of remaining mixture 37C for 1 hr
**2ul RNaseH and Riboshredder (1:1) for RNA
**1ul Exo I/III (1:1) for DNA
**1ul RNaseH and Riboshredder (1:1) for RNA
***First add 1ul 5M NaCl (100nM NaCl or KCl for Riboshredder)
***First add 1ul 5M NaCl (100nM NaCl or KCl for Riboshredder)
*94C for 2min
*94C for 2min
<!--
 
===qPCR===
===qPCR===
====Primers====
====Primers====
Line 163: Line 164:
|-
|-
| ISB_CA_AR.T3||CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG||Indx3
| ISB_CA_AR.T3||CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG||Indx3
|}
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Sample'''
| align="center" style="background:#f0f0f0;"|'''Index'''
| align="center" style="background:#f0f0f0;"|'''Forward Primer'''
| align="center" style="background:#f0f0f0;"|'''Reverse Primer'''
|-
| 1||1||ISB_CA_AF||ISB_CA_AR.T1
|-
| 2||2||ISB_CA_AF||ISB_CA_AR.T2
|-
| 3||3||ISB_CA_AF||ISB_CA_AR.T3
|-
| 4||1||ISB_CA_AF||ISB_CA_AR.T1
|-
| 5||2||ISB_CA_AF||ISB_CA_AR.T2
|-
| 6||3||ISB_CA_AF||ISB_CA_AR.T3
|}
|}


Line 188: Line 170:
| align="center" style="background:#f0f0f0;"|'''Components'''
| align="center" style="background:#f0f0f0;"|'''Components'''
| align="center" style="background:#f0f0f0;"|'''1X Volume'''
| align="center" style="background:#f0f0f0;"|'''1X Volume'''
| align="center" style="background:#f0f0f0;"|'''18X Volume'''
| align="center" style="background:#f0f0f0;"|'''16X Volume'''
|-
| Captured template||1||0
|-
| 10uM ISB_CA_AF||0.4||7.2
|-
| 10uM ISB_CA_AR.T1||0.4||7.2
|-
| 2X KAPA SYBG MM||12.5||225
|-
| H2O||10.7||192.6
|-
| Total||25||432
|}
*Aliquot 24ul from 18X master mix and add 1ul captured template
 
  Program
  98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min
[[Media:SplintR_Ligase_Test_qPCR_-_No_Enzyme_Digest.xlsx|Excel sheet with full PCR data]]<br>
[[File:SplintR_Ligase_Test_qPCR_-_No_Enzyme_Digest.JPG|450px]]
 
====PCR Test for Enzyme Digested Samples====
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Components'''
| align="center" style="background:#f0f0f0;"|'''1X Volume'''
| align="center" style="background:#f0f0f0;"|'''18X Volume'''
|-
|-
| Captured template||1||0
| Captured template||1||0
|-
|-
| 10uM ISB_CA_AF||0.4||7.2
| 10uM ISB_CA_AF||0.4||6.4
|-
|-
| 10uM ISB_CA_AR.T1||0.4||7.2
| 10uM ISB_CA_AR.T1||0.4||6.4
|-
|-
| 2X KAPA SYBG MM||12.5||225
| 2X KAPA SYBG MM||12.5||200
|-
|-
| H2O||10.7||192.6
| H2O||10.7||171.2
|-
|-
| Total||25||432
| Total||25||384
|}
|}
*Aliquot 24ul from 18X master mix and add 1ul captured template
*Aliquot 24ul from 18X master mix and add 1ul captured template
Line 231: Line 188:
   Program
   Program
   98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min
   98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min
[[Media:SplintR_Ligase_Test_qPCR_-_Enzyme_Digest.xlsx|Excel sheet with full PCR data]]<br>
[[File:SplintR_Ligase_Test_qPCR_-_Enzyme_Digest.JPG|450px]]
-->

Revision as of 23:08, 10 September 2016


SplintR Ligase Test 2

Reference

Experimental Outline

  1. V8 Padlock Probe capture to RNA
    • Ran out of V6 probes used last time
    • V8 is a subset of V6 probes (targets constitutive exons instead of contigs of exons)
  2. Quantify captured products by qPCR
    • Also adds Illumina sequencing adapters

Sample Groups

  • Use Universal Human Reference RNA (UHRR 740000-41)
  • 3 RNA template concentrations for each (30ng, 150ng and 820ng)
    • For DNA template positive control only do 1 sample using 300ng gDNA 12878
  1. NTC - 8.19ng V8 - SplintR
  2. NTC - 40.9ng V8 - SplintR
  3. NTC - 221.1ng V8 - SplintR
  4. 30ng RNA - 8.19ng V8 - SplintR
  5. 150ng RNA - 40.9ng V8 - SplintR
  6. 820ng RNA - 221.1ng V8 - SplintR
  7. PosCtrl: 300ng DNA - 16.38ng V8 - Ampligase
  8. NegCtrl: 150ng RNA - 40.9ng V8 - Ampligase
  • Summary:
    • 3 NTC samples with varying amount of padlock probes that matches experimental sample
    • 3 experimental samples of 30ng, 150ng, and 820ng UHRR
    • 1 PosCtrl that uses Ampligase for V8 to capture 300ng gDNA (876:1 probe:target ratio)
    • 1 NegCtrl that uses Ampligase for V8 to capture 150ng UHRR

Experiment

V8 Padlock Probe Capture

  • Dilute 1.5ul of 1ug/ul UHRR into 30ul total(50ng/ul final conc)
  • DNA is 12878 80.3ng/ul
  • V8 padlock probes: 874nM
    • Add 5.2ul to samples 3 & 6 and then dilute remaining ~4ul to 19ul final volume
Sample # RNA (50ng/ul) DNA (80.3ng/ul) V8 (42.7ng/ul) V8 (8.19ng/ul) 10X SplintR Buffer (*=Ampligase) H2O Total
1 0 0 0 1 3 26 30
2 0 0 0 5 3 22 30
3 0 0 5.2 0 3 21.8 30
4 0.6 0 0 1 3 25.4 30
5 3 0 0 5 3 19 30
6 16.4 0 5.2 0 3 5.4 30
7 0 3.8 0 2 3* 21.2 30
8 3 0 0 5 3* 19 30
  • Added 50ul mineral oil on top

Program

  • 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 20h
  • Add 3ul Enzyme mix prepared on ice!
    • Samples 7-8: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
    • Samples 1-6: 12ul SplintR + 2ul 10X SplintR Buffer + 6ul H2O
  • Incubate at 37C for 15min
  • 94C for 2min
  • Aliquot 10ul from each into separate strip of tubes and put at 4C for 1 hr until qPCR
  • Enzyme digest template of remaining mixture 37C for 1 hr
    • 1ul Exo I/III (1:1) for DNA
    • 1ul RNaseH and Riboshredder (1:1) for RNA
      • First add 1ul 5M NaCl (100nM NaCl or KCl for Riboshredder)
  • 94C for 2min

qPCR

Primers

Primer Sequence Index #
ISB_CA_AF AATGATACGGCGACCACCGAGATCTACACGCCTGCATATCGGGAAGCTGAAG
ISB_CA_AR.T1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTGCCTTCCCGATATCCGACGG Indx1
ISB_CA_AR.T2 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTGCCTTCCCGATATCCGACGG Indx2
ISB_CA_AR.T3 CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG Indx3

PCR Test for Non-Enzyme Digested Samples

Components 1X Volume 16X Volume
Captured template 1 0
10uM ISB_CA_AF 0.4 6.4
10uM ISB_CA_AR.T1 0.4 6.4
2X KAPA SYBG MM 12.5 200
H2O 10.7 171.2
Total 25 384
  • Aliquot 24ul from 18X master mix and add 1ul captured template
 Program
 98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min