Matt:LabNotes/2017-6-7: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
(Created page with "=Sixth Try: in tube SplintR Test with formamide= *Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditi...")
 
>Mzcai
mNo edit summary
Line 149: Line 149:
#Add mineral oil on top
#Add mineral oil on top
#Incubate at 95C for 3min
#Incubate at 95C for 3min
#Incubate at 55C for 18hr<!--
#Incubate at 55C for 18hr
#To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
#To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
#*Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
#*Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
Line 158: Line 158:
#Put all samples on ice and add 2ul Exo I/III mix
#Put all samples on ice and add 2ul Exo I/III mix
#Incubate at 37C for 1hr
#Incubate at 37C for 1hr
#Incubate at 94C for 10min
#Incubate at 94C for 10min<!--
#qPCR all 16 samples with triplicates
#qPCR all 16 samples with triplicates



Revision as of 17:34, 9 June 2017

Sixth Try: in tube SplintR Test with formamide

  • Repeat Fifth Try with 95C 3min denature before hybridization

Test Conditions

  1. Standard: SplintR only
  2. SplintR + 5% formamide
  3. SplintR + 10% formamide
  4. SplintR + 15% formamide
  5. SplintR + 1M Betaine
  6. SplintR + 10% dimethylformamide
  7. SplintR + 5% DMSO
  8. Positive Control: Ampligase
  • For each test conditions have
    • one sample with ALL padlock probes and template
      • Should see amplification
    • one sample with all padlock probes with NO MALAT1 template
      • Should not see amplification

Padlock Probes and Template

  • ppCUX2
  • ppBCL11B
  • ppRELN_1
  • ppGFAP
  • ppMALAT1
    • /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
  • Template for ppMALAT1: MALAT1_template
    • /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT

Protocol

Sample # Condition 30nM PP + Template 10X Buffer Formamide DMF Betaine DMSO H2O Total
1 SplintR 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 0 0 0 22.5 or 21.6 30
2 SplintR + 5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 1.5 0 0 0 21 or 20.1 30
3 SplintR + 10% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 3 0 0 0 19.5 or 18.6 30
4 SplintR + 15% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 4.5 0 0 0 18 or 17.1 30
5 SplintR + 10% DMF 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 3 0 0 19.5 or 18.6 30
6 SplintR + 1M Betaine 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 0 6 0 16.5 or 15.6 30
7 SplintR + 5% DMSO 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 0 0 1.5 21 or 20.1 30
8 Ampligase 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 0 0 0 22.5 or 21.6 30
  1. Combine padlock probes and template in 1X Ligase buffer and possibly additives
  2. Add mineral oil on top
  3. Incubate at 95C for 3min
  4. Incubate at 55C for 18hr
  5. To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
    • Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
  6. Move samples 1-7 to 37C
  7. Add 3ul SplintR Mix and incubate 15min
    • SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O
  8. Incubate at 94C for 10min
  9. Put all samples on ice and add 2ul Exo I/III mix
  10. Incubate at 37C for 1hr
  11. Incubate at 94C for 10min