Chris:LabNotes/sci-Methyl Seq/Calendar/2017/2017-6-13: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Cjwei
No edit summary
>Cjwei
No edit summary
Line 72: Line 72:


==Barcode 1 Adapter Design (Adpt1_v4)==
==Barcode 1 Adapter Design (Adpt1_v4)==
*We want to further modify Adpt1 from Adpt1_v3 (which added the additional CC sticky end for Adpt2 ligation) by chainging the Filler 2 sequence such that it does not contain any G's.  The reason for this is because we want the complementary sequence of Filler 2 (which would have C's) to be changed during bisulfite conversion.
*We want to further modify Adpt1 from Adpt1_v3 (which added the additional CC sticky end for Adpt2 ligation) by changing the Filler 2 sequence such that it does not contain any G's.  The reason for this is because we want the complementary sequence of Filler 2 (which would have C's) to be changed during bisulfite conversion.
*Below is the general design that we want to achieve with Adapter 1 (including the HpyCH4III cut site at the end):
*Below is the general design that we want to achieve with Adapter 1 (including the HpyCH4III cut site at the end):
                                       Filler2 (originally Filler 2 sequence was GTCCCTCCTACCCGGCGTTT, but need to change such that no G's)
                                       Filler2 (originally Filler 2 sequence was GTCCCTCCTACCCGGCGTTT, but need to change such that no G's)
Line 78: Line 78:
                                         |                  |
                                         |                  |
                                         V                  V
                                         V                  V
  Adpt1_v4:      5' /5Phos/-----<u>ACA|GT</u>-----TTDD[Barcode1]-----CC 3'
  Adpt1_v4:      5' -----<u>ACA|GT</u>-----TTDD[Barcode1]-----CC 3' (RE cut will leave behind the necessary 5Phos group)
  Adpt1_v4_comp:  3'         ^                          <-----  5' (Complementary to Filler 1 in order to do second strand synthesis)
  Adpt1_v4_comp:  3'   ^                          <-----  5' (Complementary to Filler 1 in order to do second strand synthesis)
                            |
                      |
                          Add 5bp flanking region that is enough for RE cut
                  Add 5bp flanking region that is enough for RE cut
*We want to ensure melting temperature of sequence is ~56C-60C (ideal temperature of 58C, which matches P5/P7 adapters) with a length of 18-30bp.  Consequently, we want to rerun the primergenerator.py script again to generate more potential sequences (see more information on <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-3-13> and <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-4-28>).  Below are the new parameters we want to set:
*We want to ensure melting temperature of sequence is ~56C-60C (ideal temperature of 58C, which matches P5/P7 adapters) with a length of 18-30bp.  Consequently, we want to rerun the primergenerator.py script again to generate more potential sequences (see more information on <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-3-13> and <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-4-28>).  Below are the new parameters we want to set:
**Set the temperature options to: tmoupt=58, tmmin=56, tmmax=60
**Set the temperature options to: tmoupt=58, tmmin=56, tmmax=60
**Use the noG variant of the script in order to form Filler 2 and Filler 3 (Adpt2)
**Use the noG variant of the script in order to form Filler 2 and Filler 3 (Adpt2)
**Set length parameter (-l, --plength) to 22 in order to compensate for the slightly increased melting temperature
**Set length parameter (-l, --plength) to 22 in order to compensate for the slightly increased melting temperature
*Below are the potential Filler 1 sequences:
*Below are the potential Filler 1/4 sequences:
                         Tm (C)    Primer Stats Notes (http://www.bioinformatics.org/sms2/pcr_primer_stats.html)
                         Tm (C)    Primer Stats Notes (http://www.bioinformatics.org/sms2/pcr_primer_stats.html)
  '''<u>GCACACATAGCACGACGCGATT  56.7</u>'''
  '''<u>GCACACATAGCACGACGCGATT  56.7</u>'''
Line 115: Line 115:
                                         |                                  |
                                         |                                  |
                                         V                                  V
                                         V                                  V
  Adpt1_v4:      5' /5Phos/GTTCG<u>ACA|GT'''GCACACATAGCACGACGCGATTTT'''</u>AG[AGGTG]<u>'''CAACCTCCACCTCACTCTCCTC'''</u>CC 3'
  Adpt1_v4:      5' GTTCG<u>ACA|GT'''GCACACATAGCACGACGCGATTTT'''</u>AG[AGGTG]<u>'''CAACCTCCACCTCACTCTCCTC'''</u>CC 3'
                            ^
                      ^
                            |
                      |
                          Add 5bp flanking region that is enough for RE cut (just choose a random sequence that will be cut off anyways)
                  Add 5bp flanking region that is enough for RE cut (just choose a random sequence that will be cut off anyways)
  Adpt1_v4_comp:  5' AATCGCGTCGTGCTATGTGTGC 3' (Complementary to Filler 1 in order to do second strand synthesis)
  Adpt1_v4_comp:  5' GAGGAGAGTGAGGTGGAGGTTG 3' (Complementary to Filler 1 in order to do second strand synthesis)
==Barcode 2 Adapter Design (Adpt2_v3)==
*We want to again further modify Adpt2_v2 (which was previously designed to use the ligation method) by using the following:
**Change Filler 3 sequence such that it contains no G's (otherwise, the complement would contain C's that may be converted during bisulfite conversion.  This would confound PCR off of the filler sequence)
**Add a Filler 4 sequence that will be used to form the second strand to create dsDNA Adapter 2 sequences (we will use the above

Revision as of 22:00, 13 June 2017

sci-Methyl Seq Barcode 1 Design v3; Barcode 2 Design v2

Background

  • Just yesterday, we designed new sci-Methyl Seq Adapter 1 and Adapter 2 sequences and ordered them to test whether we could ligate on Adapter 2 instead of using the current annealing method. However, looking further into the protocol, it would be prudent to begin designing Adapter 1 such that it will be appropriate for bisulfite conversion and PCR. In order to do this, we need to do the following:
    • Adjust Filler 2 such that it does not contain any G's, which would result in C's in the final sequence that may be bisulfite converted (making PCR inefficient/impossible as primers need a consistent binding site for adding the P5/P7 adapter regions)
    • Begin testing the formation of dsDNA Adpt1/Adpt2. This would require using a method similar to the HpyCH4III digestion outlined here <http://www.nature.com/nprot/journal/v9/n11/box/nprot.2014.170_BX1.html> to create the T-tailed Adpt1. dsDNA Adpt2 can be created just by using polymerization/end-repair.
    • Create final PCR primers that will add the P5/P7 sequencing adapters to both ends of the DNA fragment

Overview

End Repair/dA-Tailing
     5'  -----A 3'
     3' A-----  5'
           |
           V
Add Adpt1_v3:     5' /5Phos/-----TTDD[Barcode1]-----CC 3'
                  3'       T-----AADD[Barcode1]----- 5'
           |
           V
Ligate Adpt1_v3 (using same optimized ligation protocol as before)
     5'   -----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC 3'
     3' CC-----[Barcode1]DDTT-----|A-----|T-----AADD[Barcode1]----- 5'
           |
           V
Add Adpt2_v2:     5' /5Phos/-----[Barcode2]DDDDDDDD----- 3'
                  3'      GG-----[Barcode2]DDDDDDDD----- 5'
           |
           V
Ligate Adpt2_v2 (using same optimized ligation protocol as before)
                                     Nick
                                      V
     5' -----DDDDDDDD[Barcode2]-----GG|-----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3'
     3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]DDTT-----|A-----|T-----AADD[Barcode1]-----|GG-----[Barcode2]DDDDDDDD----- 5'
                                                                                                ^
                                                                                               Nick
           |
           V
Denature/separate fragments (will break up DNA at nicks)
    5' -----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3'

    3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]DDTT-----|A-----|T-----AADD[Barcode1]----- 5'
           |
           V
Bisulfite conversion
           |
           V
PCR, 1st cycle (Add P7 sequencing adapters)
 P5: 5' AATGATACGGCGACCACCGA 3'
 P7: 5' CAAGCAGAAGACGGCATACGAGAT 3'
    5' -----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC|-----[Barcode2]DDDDDDDD----- 3'
                                                                                      3' <-----
                                                                                               \
                                                                                                P7 5'
  5' P7
      \
       -----> 3'
    3' -----DDDDDDDD[Barcode2]-----|CC-----[Barcode1]DDTT-----|A-----|T-----AADD[Barcode1]----- 5'
           |
           V
PCR, 2nd cycle (Add P5 sequencing adapters)
 5' P5
     \
      -----> 3'
   3' -----[Barcode1]DDTT-----A|-----T|-----AADD[Barcode1]-----GG|-----[Barcode2]DDDDDDDD-----P7 5'

   5' P7-----DDDDDDDD[Barcode2]-----|GG-----[Barcode1]DDAA-----|T-----|A-----TTDD[Barcode1]----- 3'
                                                                                        3' <-----
                                                                                                 \
                                                                                                  P5 5'
           |
           V
PCR Product
5' P5-----[Barcode1]DDAA-----T|-----A|-----TTDD[Barcode1]-----CC|-----[Barcode2]DDDDDDDD-----P7 3'

Barcode 1 Adapter Design (Adpt1_v4)

  • We want to further modify Adpt1 from Adpt1_v3 (which added the additional CC sticky end for Adpt2 ligation) by changing the Filler 2 sequence such that it does not contain any G's. The reason for this is because we want the complementary sequence of Filler 2 (which would have C's) to be changed during bisulfite conversion.
  • Below is the general design that we want to achieve with Adapter 1 (including the HpyCH4III cut site at the end):
                                     Filler2 (originally Filler 2 sequence was GTCCCTCCTACCCGGCGTTT, but need to change such that no G's)
                                        |                 Filler1 (Originally was omitted in Adpt1 because was extraneous, but need to add back in order to form second strand)
                                        |                   |
                                        V                   V
Adpt1_v4:       5' -----ACA|GT-----TTDD[Barcode1]-----CC 3' (RE cut will leave behind the necessary 5Phos group)
Adpt1_v4_comp:  3'   ^                          <-----   5' (Complementary to Filler 1 in order to do second strand synthesis)
                     |
                 Add 5bp flanking region that is enough for RE cut
                        Tm (C)     Primer Stats Notes (http://www.bioinformatics.org/sms2/pcr_primer_stats.html)
GCACACATAGCACGACGCGATT  56.7
TTGACTGCTGTGGAGTCGTTCG  56.7
GTACCTCGCCCGTTACCTTCGT  58.6       Warning: There are more than 3 self-annealing bases
GTTGGGCCGACACACTTGAGAA  56.7
TGAGGCTCACTATGCGATCCTC  56.7       Warning: There are more than 3 self-annealing bases; There are more than 3 hairpin bases
AAGTGCGGACCCCCAATGCATC  58.6       Warning: There are more than 3 self-annealing bases
GTGGGTCGACAAAGCATCCCCT  58.6       Warning; There are more than 3 Gs or Cs in the last 5 bases
GTGTCTGCCACTGCCTCTCTTT  56.7
TAGCCGACTGGGAAGTCCCCAT  58.6       Warning: There are more than 3 self-annealing bases; There are more than 3 hairpin bases
GGCCTACGACTACTGTCTGCGA  58.6       Warning: There are more than 3 self-annealing bases (Also contains the HpyCH4III cut site in sequence)
  • Below are the potential Filler 2/3 (noG) sequences:
                        Tm (C)     Primer Stats Notes
CATCTCCACTACCCCCCAACCT  58.6       Warning: Contains run of C's
TTCACCTCACCTTACCACCCCC  58.6       Warning: Contains run of C's; There are more than 3 G's or C's in the last 5 bases
CAACCTCCACCTCACTCTCCTC  58.6
TCCATCTTCCCACCCATCTCCC  58.6       Warning: Contains run of C's; There are more than 3 G's or C's in the last 5 bases
CCCCACACTCCCCCAAAACCAA  58.6       Warning: Contains run of C's
TCCCCCCCCTCATACTCACTTC  58.6       Warning: Contains run of C's
TCCCCCCCTCAACTCAACACTC  58.6       Warning: Contains run of C's
TCCACACAACCCCCCAACCTCT  58.6       Warning: Contains run of C's
TCCCTCCCATTATCTCCACCCT  56.7
ATTACATCCACCCCCCTCACTC  56.7       Warning: Contains run of C's
  • Consequently, using the above Filler 1/2 sequences, we can make the necessary Adapter 1 oligos as follows: (using a set Barcode 1 [AGGTG] and DD [AG] sequence)
                                     Filler2 (originally Filler 2 sequence was GTCCCTCCTACCCGGCGTTT, but need to change such that no G's)
                                        |                                Filler1 (Originally was omitted in Adpt1 because was extraneous, but need to add back in order to form second strand)
                                        |                                  |
                                        V                                  V
Adpt1_v4:       5' GTTCGACA|GTGCACACATAGCACGACGCGATTTTAG[AGGTG]CAACCTCCACCTCACTCTCCTCCC 3'
                     ^
                     |
                  Add 5bp flanking region that is enough for RE cut (just choose a random sequence that will be cut off anyways)
Adpt1_v4_comp:  5' GAGGAGAGTGAGGTGGAGGTTG 3' (Complementary to Filler 1 in order to do second strand synthesis)

Barcode 2 Adapter Design (Adpt2_v3)

  • We want to again further modify Adpt2_v2 (which was previously designed to use the ligation method) by using the following:
    • Change Filler 3 sequence such that it contains no G's (otherwise, the complement would contain C's that may be converted during bisulfite conversion. This would confound PCR off of the filler sequence)
    • Add a Filler 4 sequence that will be used to form the second strand to create dsDNA Adapter 2 sequences (we will use the above