AlanFung:LabNotes/CTCF/2010-6-7

From ZhangLabWiki
Jump to navigation Jump to search

Prepare PCR Product from Jurkat gDNA

ul
primer 1
h2o 7
template 2
Econo 2x 10
  • Program: 94C 2min-> (94C 40sec-> 52C 40sec -> 72C 60 sec) x 2 -> 72C 10min -> 15C hold
  • Qiaquick Purification
  • Nanodrop

P7-6.4ng/ul P10-5.4ng/ul

  • Gel Quant

File:ZhangLab 2 2010-06-07 14hr 34min.jpg

Protocol

Obtain 100ng Jurkat DNA
  • 100ng/(6.4ng/ul)=15.63ul
  • 100ng/(5.4ng/ul)=18.52ul
P7 P10
Jurkat DNA PCR Product 15.63 18.52
ddH2O 69.37 66.48
End Repair Reaction Buffer (10x) 10 10
Repair Enzyme Mix 5 5
  • Incubate 30 mins at 20C
Purification using qiaquick column
  • Elute with 50ul buffer
Perform A-tailing protocol (6/8/10)
  • Add in 6ul dA-tailing Reaction buffer
  • Add in 4ul klenow fragment
  • Incubate at 37C for 30mins


Purification using qiaquick column
  • Elute with 50ul buffer
Adapter ligation
  • Mix 1ul methylation adapter
  • Mix 5ul ligase
  • Mix 14ul ligase buffer
  • Incubate @20c for 30mins

Purification using qiaquick column

  • Elute with 50ul buffer


CT Conversion (6/3/10)
  • Take 46ul to perfrom CT conversion
an additional 1m
Bisulfite conversion of DNA
  • Add 46ul of sample to 130ul of CT conversion reagent solution in a pcr tube
  • Vortex the sample to mix
  • Pulse centrifuge
  • Perform
*98C for 8m
*64C for 3.5hr
*4C hold
  • Add 600ul of M binding buffer into a column assembly
  • Load sample(s) to the column
  • Close the cap and mix by inverting the column several times
  • Centrifuge at >10,000g for 30sec
  • Discard the flow through
  • Add 100ul of M-Wash Buffer to the column
  • Centrifuge at full speed for 30sec
  • Add 200ul of M-Desulphonation buffer to the column and let stand at RT for 20m
  • Centrifuge at full speed for 30sec
  • Add 100ul of M-Wash Buffer to the column
  • Centrifuge at full speed for 30sec
  • Place the column into a 1.5ml tube
  • Add 50ul of M-elution buffer directly to the column matrix (Volume can be adjusted, depending on the requirements)
  • Centrifuge for 30sec to elute the DNA

Perform PCR to bisulfite converted DNA using Phusion/iProof 6/9/10

  • Primer
PCR_F Sol. Amp. (Forward) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3'-Phosphorothioate bond [2]
PCR_R Sol. Amp. (Reward) CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T 3'-Phosphorothioate bond [2]
1rxn 4.4rxn
Phusion 50 220
PCRF 0.5 2.2
PCRR 0.5 2.2
SYBG 0.8 3.52
P7 CTC P7 P10 CTC P10
DNA 4 50 4 50
H2O 46 0 46 0
Mix 50 50 50 50
a.Set up the reaction system with Phusion High-Fidelity PCR master mix:
  2x Phusion master mix:     50ul
  100uM PCR_F		     0.5ul
  100uM PCR_R		     0.5ul
  50X SYBG I		     0.8ul
  Captured DNA		     50ul
b.Perform real-time PCR with 98C 30s -> 20 x (98C 10s -> 63C 20s-> 72C 20s) -> 72C 2min. 
Terminate the reaction when the amplification curves approach to the plateau.

File:ZhangLab 2 2010-06-09 11hr 23min.jpg