Noi/NOTES/2011-10-6
Jump to navigation
Jump to search
Plan of probe (from LC Bioscience) production
- Follow the protocol: [1] and standard protocol using to make DMR330k probe set
- After receiving the probes, resuspend with H2O to the concentration 20 nM (in case it is lyophilized)
- perform expansion PCR to amplify the probes as the template
Expansion PCR
Components | Volume (ul) | Final conc. |
20nM LC Sciences Oligoes | 10.00 | 0.2nM |
eMIP_CA1_F (100uM) | 0.80 | 400nM |
eMIP_CA1_F (100uM) | 0.80 | 400nM |
2x Kapa SYBG MM | 100.00 | 1x |
H2O | 88.40 | |
Total | 200.00 |
Program
95C 20sec -> (95C 5sec -> 52C 60sec-> 72C 30sec) x 5 -> (95C 3sec -> 62C 30sec-> 72C 30sec) x N -> 72C 2min -> 15C hold
- Primer info.
- eMIP_CA1_F: TGCCTAGGACCGGATCAACT (TGCCT overhang), Tm of the short one = 53.06C, the long one = 63.28C
- eMIP_CA1_R: GAGCTTCGGTTCACGCAATG (GAGCT overhang), Tm of the short one = 54.41C, the long one = 62.95C
- Note:
- The first three cycles, Tm of each primer was calculated without 5 nt overhang, then the Tm was increased based on the Tm of the full length primer
- The number of cycles will be monitored
- Purified with Qiaquick column and elute with EB buffer volume 50ul
- Measure DNA conc. with Nanodrop and adjust conc. to 10nM for using as the template for the future amplification
- Perform production PCR
Production PCR
Components | 1 rxn | 32x rxn mix |
1st round amplicon (10nM) | 0.20 | 6.40 |
eMIP_CA1_F (100uM) | 0.40 | 12.80 |
eMIP_CA1_R (100uM) | 0.40 | 12.80 |
2x Kapa SYBG MM | 50.00 | 1600.00 |
H2O | 49.00 | 1568.00 |
Total | 100.00 | 3200.00 |
Program
95C 30sec -> (95C 3sec -> 52C 30sec-> 72C 20sec) x 16 -> 60C 2min -> 15C hold
- The number of cycles will be monitored to prevent overamplification