Rui:DNAseq analysis on Hiseq120313

From ZhangLabWiki
Revision as of 08:46, 27 April 2012 by >RuiLiu (→‎Validation)
Jump to navigation Jump to search

Hiseq_120313

Sample preparation

[1]

Flow cell

  • s1-2: RL_B2_23s_Mar8.2012
  • s5-6: RL_B3_24s_Mar8.2012
  • s7-8: RL_Fib-Bulk_Mar8.2012

Mapping

  • fastq
Genome-miner: /media/SeqStore2/120315_HiSeq/Genome
Triton: /projects/zhang-lab/seqStore/120313_HiSeq/Genome
  • prepare to submit jobs in triton
info file: File:B2 Indx73.info.txt
job file: File:B2 Indx73.job.txt
  1. An unique name for each library/index
  2. Excel or plain text for info/job files, tab-delimited plain text
  3. upload to triton (attn: space/line problems in nano format)
  4. tr "/r" "/n" < info.txt > info (convert to unix format)
  5. sed "s/73/xx/g" < 73.info > xx.info (convert to other index)
  6. qsub xx.job
  7. qstat | grep rul (check running status)
  8. qdel xxxx (kill job)
  9. triton contact info: Jim Hayes <jhayes@sdsc.edu> [2]
  • following analysis
[3]


Validation

  • multiple bands / unknown sequence in PCR results -> confirm primers on gDNA
  • negative SNCs -> positive aliquot PCR
PCR-ID Gene Cat. chr pos refBase B2B3(GT) Pf Pr PCR '
SNC1 GLT25D2 (glycosyltransferase 25 domain containing 2) exon 1 183907978 G G=7/T=3 CAGGGAGCCTTCATAGCTCA ACCTGAGTGACACGGAGACC 189bp >chr1:183907885+183908073
QC good Fib P30 B2 B3 B2_MDA B3_MDA
PCR 1 band 1 band
seq. ID RL01_R RL02 RL03 RL04 RL05 RL06
seq. length 350 160 160 160 160 70
blast 183907925 183908073 183907925 183908071 183907932 183908074 183907932 183908074 183907930 183908071 183907997 183908070
identity 100% 100% 100% 100% 100% 100%
SNC G G G G G (T? C?) N/A
aliquot B2_Indx80,B2_Indx93,B3_Indx93
PCR-ID Gene Cat. chr pos refBase B2B3(GT) Primers PCR
SNC2 FLNB (actin binding protein 278) exon 3 58104657 C C=6/G=3 TTTGGTACCCAAAGGTAAACTGA 191
CAACCCATCTGCTCTCCATT >chr3:58104557+58104747
failed, repeat Fib P30 B2 B3 B2_MDA B3_MDA
PCR
seq. ID RL09 RL10_R RL11_R RL12 RL13 RL14
seq. length 141 330 141 170 70
blast 183907930 183908070 58104610 58104747 58104607 58104747 183907950 183908060 183907997 183908061
identity 98% 100% 100% 94%
SNC SNC1? T? C C SNC1? T? no match SNC1? N/A
aliquot B2_Indx80,B2_Indx82,B3_Indx92