Rui:LabNotes/SingleCell/2013-7-31
Jump to navigation
Jump to search
mNPC plate with the latest version of hiMg-TSO and hiMg-IVT protocols
- The latest version of hiMg-TSO and hiMg-IVT protocols confirmed on 7/29/13
- I didn't use Betaine because it hasn't come in yet
- mNPC plate was sorted on 7.10.13 in hiMg buffer [1]
- I only have 24 RL.T7.id01-24 with no VN
- I also use 24 T20V.id01-24 for TSO or 2 step IVT
Design
Procedures
- 2ul Lysis: the long procedure originally used for fluidigm
- 3ul PNK: 1mM ATP, RNase-In (1:2d), PNK (1:2d)
- 4ul PAP: 1mM ATP, PAP (1:10d)
- 10ul RT: 3ul 0.2uM T20.id01-24 or RL.T7.id01-24
- beads pools into 4 tubes, 3 column each (240ul beads + 240ul rec.)
- TSO with TSO.r04 or TSO.r05 (LNA)
- 2nd strand in 20ul
- T7 addition for T20.id01-24 for 2 step IVT
- beads purification
- IVT in 20ul for 12 hrs
- Directly take 2ul for a quick run (RT-PCR), purify the rest with Zymo kit
- RT with N6 or N9
- QPCR for 12 cycles
- Redo RT-PCR with adjusted aRNA input (3ul, 6ul, 6ul, 6ul from IVT-1,2,3,4)
- The rest of aRNAs were store at -80C (Rui Cell (MEF) box) with label 8.1.13 IVT#1,2,3,4.
- beads purification or size selection (if primer-dimer is an issue)
Results
- IVT-1: 24 SCs (RL.T7.id01-24), 1 step IVT, N6 RT-PCR, N2.id09
- IVT-2: 24 SCs (RL.T7.id01-24), 1 step IVT, N9 RT-PCR, N2.id10
- IVT-3: 12 SCs (T20.id01-24), 2 step IVT, N6 RT-PCR, N2.id11
- IVT-4: 12 SCs (T20.id01-24), 2 step IVT, N9 RT-PCR, N2.id12
- IVT-1: 12 SCs (T20.id01-24), TSO with TSO.r04, N2.id14
- IVT-2: 12 SCs (T20.id01-24), TSO with TSO.r05, N2.id15
Libraries
- IVT1: RL-hiMgIVT_N2id09-Aug1
- IVT2: RL-hiMgIVT_N2id10-Aug1
- IVT3: RL-hiMgIVT_N2id11-Aug1
- IVT4: RL-hiMgIVT_N2id12-Aug1
- TSO1: RL-hiMgTSO_N2id14-Aug1
- TSO2: RL-hiMgTSO_N2id15-Aug1
Read 1: [totoRNAseq Read 1 v2] CCACCGAGATCTACACTCTTTCCCTACACGACG
Read 2: [N2 Read 2]
Barcode read:
- [N2Indseq]
- [RL.T7.IndSeq] AAAAAAAAAAAAAAAAAAAAGCGGGCTGGCAAGG