Matt:LabNotes/2016-3-31
Jump to navigation
Jump to search
Bead with PKP2 Target for DARTFISH Positive Control=
- Using PA gel may prevent diffusion of probes and enzymes during DARTFISH
- To test this and to have a positive control for future experiments need to design a synthetic target
- Attach target to magnetic streptavidin bead
- Design oligonucleotide with biotin 5' modification
- Chose PKP2 gene because haven't detected it in any DARTFISH samples
- Also this specific padlock probe has very high efficiency when measured in tube
PKP2_control /5BiosG/AAAAAAGAGATGGCTGTCTTTTTCACACTTGGGTCACCAACATGCAGCATCTTTC