Matt:LabNotes/2016-3-31

From ZhangLabWiki
Jump to navigation Jump to search

Bead with PKP2 Target for DARTFISH Positive Control=

  • Using PA gel may prevent diffusion of probes and enzymes during DARTFISH
  • To test this and to have a positive control for future experiments need to design a synthetic target
    • Attach target to magnetic streptavidin bead
  • Design oligonucleotide with biotin 5' modification
    • Chose PKP2 gene because haven't detected it in any DARTFISH samples
    • Also this specific padlock probe has very high efficiency when measured in tube
 PKP2_control	/5BiosG/AAAAAAGAGATGGCTGTCTTTTTCACACTTGGGTCACCAACATGCAGCATCTTTC

Link PKP2_control oligo to Streptavidin Bead

Measure DNA Concentration

Capture with CA12kNov2014 V4 in tube

Reference protocol

PCR + Sequencing Adapters