AlanFung:LabNotes/EZ/2009-3-24

From ZhangLabWiki
Revision as of 22:29, 25 March 2009 by >Alan6017518 (→‎2nd PCR run on GM20431 100 & 10 cells - on remaining eluted DNA)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

2nd PCR run on GM20431 100 & 10 cells - on remaining eluted DNA

Objective

  • Confirmation of the bisulfite conversion of GM20431 for 100 and 10 cells.
  • Increase the amount of template DNA to be used for PCR reaction


Samples & Materials

  • GM20431 cells
  • EZ DNA Methylation Direct Kit 03/11/09
  • Primers - From IDT
  --------------------------------------------------
  0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG
  0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA
  0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT
  0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA
  0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT
  0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA
  --------------------------------------------------
  • Creating 100uM primer
0.1_F_chr22         27.9nmol 
RNAse free H2O      279uL
0.1_R_chr22         31.8nmol
RNAse free H2O      318uL
0.8_F_chr21         31.30nmol
RNAse free H2O      313uL
0.8_R_chr21         31.70nmol
RNAse free H2O      317uL
0.9_F_chr8          30.10nmol
RNAse free H2O      301uL
0.9_R_chr8          29.30nmol
RNAse free H2O      293uL

  • Making 3.3uM primer working solution

Dilute 33uL 100uM primer with 967uL RNAse free H2O

  • Jurkat gDNA (100ug/mL)
  • Dilute 1uL stock gDNA with 99uL RNAse-free H20
  • Agarose Gel

Overview

  • PCR amplification
  • Agarose Gel Electrophoresis

Procedures

  • PCR


 Sample A 100 cell GM20431
                     A         B         C
 -------------------------------------------------
                     CHR22     CHR21     CHR8
 2X iQ Super Mix     20        20        20
 Primer F (3.3uM)    6         6         6  
 Primer R (3.3uM)    6         6         6     
 gDNA                2.8       2.8       2.8   
 RNAse free H20      5.2       5.2       5.2  
 -------------------------------------------------
 Total                                   40uL


 Sample B 10 cell GM20431
                     A         B         C
 -------------------------------------------------
                     CHR22     CHR21     CHR8
 2X iQ Super Mix     20        20        20
 Primer F (3.3uM)    6         6         6  
 Primer R (3.3uM)    6         6         6     
 gDNA                2.8       2.8       2.8   
 RNAse free H20      5.2       5.2       5.2  
 -------------------------------------------------
 Total                                   40uL


A-CHR22 F/R
B-CHR21 F/R
C-CHR8  F/R


Perform PCR reaction in thermocycler

      Step1   96C, 3m
      Step2   95C, 30s
      Step3   62C, 1m
      Step4   72C, 1m
      Step5   Go to step2 repeat 39 times
      Step6   72C, 5m
      Step7   4C,  Forever
  • Gel Electrophoresis
                                 Gel 1
Well             1     2     3     4     5    6     7      8
-----------------------------------------------------------------
Content          Blank AA    AB    AC    BA   BB    BC     Ladder
Sample           0     10    10    10    10   10    10     3
6X Loading Dye   0     2     2     2     2    2     2      3
-----------------------------------------------------------------
Total                                               14uL   9uL



  • Run gel at 135 V for 20 min.

Result

File:ZhangLab 2 2009-03-25 09hr 42min crop.jpg

  • All 3 pairs of primers showed up on the 100 cells methylation
  • No bands at all for the 10 cells methylation

Sugestion

  • Repeat 10 cells methylation
  • Elute DNA with 8uL elution buffer
  • Use all 8uL dna as template for one pair of primer
  • Reduce washing step from two times to one
  • For one set (3x10cells- one washing before elution)
  • For the other set (2x10cells-two washing before elution