Chris:LabNotes/sci-Methyl Seq/Calendar/2017/2017-5-17
Jump to navigation
Jump to search
sci-Methyl Seq Barcode 1 Design v2
Background
- Previously, I've designed Adapter 1 with a CG sticky end that would anneal directly onto MspI digested DNA. However, as previous tests have shown, this approach doesn't work because of the high amounts of adapter-adapter and template-template annealing that goes on.
- Dr. Zhang then suggested that we look into using end-repair/dA-tailing prior to adapter ligation. This will ensure that the majority of ligated product are template+adapter. Consequently, we want to make a slight edit to the Adapter 1 test design to include a T-overhang instead of current CG overhang
Barcode 1 Adapter Design (v2)
- Based on what we know from dA-tailing, an A will be added to the 3' end of blunt-ended DNA. Consequently, the DNA fragment after end-repair/dA-tailing would be:
5' -------------------A 3' 3' A------------------- 5'
- Consequently, our Adapter 1 v2 design should be as follows: (remember we want to create a dsDNA adapter for ligation)
5' /5Phos/------------------- 3' 3' T------------------- 5'
- Below are the sequences we want to order from IDT:
Adpt1_v2 5' /5Phos/TTAGAGGTGGTCCCTCCTACCCGGCGTTT 3' Adpt1_v2_comp 3' TAATCTCCACCAGGGAGGATGGGCCGCAAA 5'