AlanFung:LabNotes/Sequencing/2009-11-25
Jump to navigation
Jump to search
Overview
CVF-N(A-D Shearing), CVF-N (A,B USER), CVF-N (A-D USER)
- Fragmentation and end-polishing
- Size Selection
- Ligation
- PCR of sequencing Library
- QPCR quantification
Fragmentation and end-polishing (Make blunt ends with 5'P)
- End-Repair Reactions
Fragmented DNA | 85ul |
10X End Repair Bufer | 10ul |
End Repair Enzyme Mix | 5ul |
- Incubate tubes at RT for 30minutes.
- Perform a Qiaquick purification and elute with 39ul EB buffer.
- NOTE: For blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the chance of getting chimeric reads.
- A-Tailing Reactions
Blunet-end DNA | 37ul |
10X dA-Tailing Reaction Buffer | 5ul |
Klenow Fragment (3'-5' exo-) | 3ul |
H2O | 5ul |
Incubated at 37C for 30min, purified with Qiaquick columns, eluted with 40 ul EB.
- Measure concentration with nanodrop
CVF-N USER A-B 3.8ng/ul CVF-N USER A-D 3.3ng/ul CVF-N Shearing 11.2ng/ul
- Speed vac. the first 2 to ~20ul and run in 1 well in the size select gel
Size selection using Invitrogen 2% SizeSelect gel
- Fill any unused well with 30ul EB Buffer
- Mix 15ul EB buffer with 0.5ul ladder in a 0.2ml tube
- Load 20u end-polished DNA sample into two lanes(use 3 or more lanes if the starting DNA is more than 1ug)
- Run the SizeSelect program for 12~14 min. Pause when the 125bp band just move into the middle collection well
- Use pipette to extract all solution in each of the sample well, and quickly refill the wells with 20ul EB.
- Resume the electrophoresis for additional 15sec, extract DNA and refill the wells with 20ul EB. *Resume the electrophoresis for additional 15sec, extract DNA (all the extracted DNA from the same sample are mixed in a tube)
- Refill the wells with 20ul EB, and run the electrophoresis for additional 3 minutes. Take a picture of the gel to document the extracted fragment sizes.
File:ZhangLab 2 2009-11-25 17hr 16min.jpg
- Concentrate the DNA with a SpeedVac (no heat) to ~36ul (takes about 1hour).
Ligation. Blunt-end and TA ligations use the same protocol but slightly different adaptor sequences.
- Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time.
ul | |
End-repaired & size selected DNA | 36 |
40uM adaptor2 | 2 |
5X Quick Ligase Buffer | 10 |
Quick Ligase | 2 |
- Incubate at room temperature for 15 minutes, purified with MinElute columns, eluted with 20ul EB.
PCR of sequencing library
Solexa_PCR_up: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
AmpR6.3Sol: CAAGCAGAAGACGGCATACGAGCTCTTCGGAACGATGAGCCTCCAAC
AmpF6.3rSol: CAAGCAGAAGACGGCATACGAGCTCTTCCAGATGTTATCGAGGTCCGA
- prepare 2 master mix tube
F | R | |
10uM Solexa_PCR_up | 6.6 | 6.6 |
10uM AmpR6.3Sol | 0 | 6.6 |
10uM AmpF6.3Sol | 6.6 | 0 |
2X Phusion | 165 | 165 |
50X SYBR Green I | 1.32 | 1.32 |
H2O | 118.8 | 118.8 |
Ligation products | 10 | 10 |
10uM solexa PCR up | 2 | 2 |
10uM AmpR6.3Sol | 2 | - |
10uM AmpF6.3Sol | - | 2 |
2X Phusion | 50 | 50 |
50X SYBR Green I | 0.4 | 0.4 |
H2O | 36 | 36 |
- 90ul mix per well
- Setup
CVF-N-F (Shearing) CVF-N-R (Shearing) CVF-N-F (A-B) CVF-N-R (A-B) CVF-N-F (A-D) CVF-N-R (A-D)
PCR program: 98 °C 30sec -> 8 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold.
- TBE Gel verification (10well)
- 10ul h2o+4.5ul 6x loading dye+0.5ul 25bp ladder
- 10ul h2o+3ul 6X loading dye+2ul sample
File:ZhangLab 2 2009-11-25 19hr 56min.jpg
- Mix the amplicons with two sets of primers
- Purified with Minelute columns, elute with 32ul EB buffer
CVF-N (Shearing) 18.1ng/ul *30ul=543ng CVF-N (A-B) 27ng/ul *30ul=810ng CVF-N (A-D) 38.8ng/ul *30ul=1164ng
TBE Gel Size Selection
- Run samples in 3 lanes and ladder in 2 lanes in in a 5-well TBE gel
- Load 2 lanes with 25bp ladder Mix in a .2ml tube(30ul H2O+9ul 6X loading dye+1ul 25bp ladder)/2
- Mix (30ul library + 15ul 6X loading dye + 15ul h20)/3 load to 3 wells
File:ZhangLab 2 2009-11-22 14hr 43min.jpg File:ZhangLab 2 2009-11-22 14hr 46min.jpg File:ZhangLab 2 2009-11-22 16hr 28min.jpg File:ZhangLab 2 2009-11-22 16hr 41min.jpg