Rui:DNAseq analysis on Hiseq120313
Jump to navigation
Jump to search
Hiseq_120313
Sample preparation
Flow cell
- s1-2: RL_B2_23s_Mar8.2012
- s5-6: RL_B3_24s_Mar8.2012
- s7-8: RL_Fib-Bulk_Mar8.2012
Mapping
- fastq
Genome-miner: /media/SeqStore2/120315_HiSeq/Genome Triton: /projects/zhang-lab/seqStore/120313_HiSeq/Genome
- prepare to submit jobs in triton
info file: File:B2 Indx73.info.txt job file: File:B2 Indx73.job.txt
- An unique name for each library/index
- Excel or plain text for info/job files, tab-delimited plain text
- upload to triton (attn: space/line problems in nano format)
- tr "/r" "/n" < info.txt > info (convert to unix format)
- sed "s/73/xx/g" < 73.info > xx.info (convert to other index)
- qsub xx.job
- qstat | grep rul (check running status)
- qdel xxxx (kill job)
- triton contact info: Jim Hayes <jhayes@sdsc.edu> [2]
- following analysis
[3]
Validation
- multiple bands / unknown sequence in PCR results -> confirm primers on gDNA
- negative SNCs -> positive aliquot PCR
PCR primers
PCR-ID | Gene | Cat. | chr | pos | refBase | B2B3(GT) | positive aliquot | Pf | Pr | length | position |
SNC1 | GLT25D2 | exon | 1 | 183907978 | G | G=7/T=3 | B2_Indx80,B2_Indx93,B3_Indx93 | CAGGGAGCCTTCATAGCTCA | ACCTGAGTGACACGGAGACC | 189 | >chr1:183907885+183908073 |
SNC2 | FLNB | exon | 3 | 58104657 | C | C=6/G=3 | B2_Indx80,B2_Indx82,B3_Indx92 | TTTGGTACCCAAAGGTAAACTGA | CAACCCATCTGCTCTCCATT | 191 | >chr3:58104557+58104747 |
SNC3 | PPP1R9A | exon | 7 | 94918006 | G | A=3/G=6 | B3_Indx82,B3_Indx95,B3_Indx96 | AGTGTGCAGCAGGTTTCTCA | CCTCTCAGATATGCAGAATGCTC | 223 | >chr7:94917911+94918133 |
SNC4 | POU5F1P3 (in CLEC4A) | exon, pseudogene | 12 | 8286643 | C | C=13/G=6 | B2_Indx81,B2_Indx83,B2_Indx87,B2_Indx93,B3_Indx83,B3_Indx88 | GAGACCCAACAGCCTCAAAA | AGTGAGAGGCAACCTGGAGA | 191 | >chr12:8286540+8286730 |
SNC5-6 | POU5F1P4 (in ASH1L) | exon, pseudogene | 1 | 155403537 | G | C=5/G=6 | B2_Indx81,B2_Indx88,B2_Indx91,B2_Indx93,B3_Indx74 | AACAATTTGCCAAGCTCCTG | TGCAAGAGGGTTTCTGCTTT | bad | chr1; chr8; chr6 (X5) |
POU5F1P4 (in ASH1L) | exon, pseudogene | 1 | 155403505 | G | A=5/G=5 | B2_Indx88,B2_Indx91,B2_Indx93,B3_Indx74,B3_Indx95 | |||||
SNC7 | (in DAB1) | Ensemble psedogene | 1 | 58694451 | A | A=12/G=3 | B2_Indx77,B2_Indx86,B3_Indx92 | CTGGGGTTCTTGGACCTTCT | GATGCTCTGGGCCTCTGTC | 178 | >chr1:58694376+58694553 |
SNC9 | Ensemble psedogene | 9 | 7598174 | C | C=11/T=4 | B2_Indx73,B2_Indx81,B2_Indx84,B3_Indx73 | CACTGGCAGCAAGTCAATCT | GCCATCCAACCACTCAGTCT | 158 | >chr9:7598095+7598252 158bp | |
SNC10 | (in PLXNC1) | intron; repeats | 12 | 94620564 | T | C=3/T=13 | B2_Indx91,B3_Indx75,B3_Indx96 | CCAGGTAAAGTGACATTTTTGG | AGGACCAGGCAGTCACAAAC | 369 | >chr12:94620480+94620848 369bp |
SNC11-12 | Ensemble psedogene | 9 | 7598190 | A | A=10/G=5 | B2_Indx73,B2_Indx79,B2_Indx81,B2_Indx84,B3_Indx73 | GGGTTCCTGCTTTCACAAAA | TTGCTGAAGACCACATGCTT | 247 | >chr9:7598026+7598272 247bp | |
Ensemble psedogene | 9 | 7598203 | C | C=12/T=5 | B2_Indx73,B2_Indx79,B2_Indx81,B2_Indx84,B3_Indx73 | ||||||
SNC14 | GOT2L2 | exon, pseudogene | 10 | 93897290 | A | A=11/G=3 | B2_Indx74,B2_Indx86,B3_Indx84 | CCAAAAGCTCAACAGCAACA | TCCACTCCTCATGTTCCACA | 176 | >chr10:93897208+93897383 176bp |
SNC13 | EIF4A1P8 (in CPEB3) | exon, pseudogene | 1 | 173111263 | C | C=7/T=3 | B3_Indx82,B3_Indx84,B3_Indx92 | TCACCCAGGGTTGGTTCTAC | TGGGAGTCACTGAAGCCTTT | 204 | >chr1:173111163+173111366 204bp |
SNC15 | (in EP300) | intron | 22 | 41572232 | G | A=3/G=8 | B2_Indx79,B2_Indx88,B2_Indx91 | GAGGATCAGGATCAACAATGG | GTGCTCAGCCTGCTGTACCT | 388 | >chr22:41571936-41572323 388bp |
SNC16 | UPF3A | exon | 13 | 115047559 | C | C=5/T=3 | B2_Indx74,B2_Indx78,B2_Indx86 | GTTCCGCCCTCTCTTCCTC | CCTTTTGAGCTCCTTGTCCA | 204 | >chr13:115047437-115047640 204bp |
SNC377 | SEZ6 | exon; repeats | 17 | 27296926 | T | C=3/T=10 | B2_Indx74,B2_Indx91,B3_Indx76 | AGGCAGCAGGAAGAAGTCTG | CAGCAGGAAAGACTGGTTGG | 151 | >chr17:27296875-27297025 151bp |
- PCR product from primers on P30 gDNA
File:4.27.12 PCR1-7.jpg File:4.27.12 PCR8-14.jpg