Brandon:LabNotes/Project1/2012-6-6

From ZhangLabWiki
Revision as of 18:30, 7 June 2012 by >Bsos (→‎Rnase III protocol)
Jump to navigation Jump to search

RNA fragmentation protocols, RNase III, Mg++

For RNA fragmentation information see RNA fragmentation info


  • After IVT with T7, RNA generated and needs to be fragmented.
  • protocol for IVT RNA -> RNase III fragmentation -> PolyA polymerase (MMLV buffer) -> MMLV RT -> PCR amplification


  • possible issues
    • run with and without 5' blocking primer for DNA-RNA hybrid.
    • might need to purify after T7 IVT, since [Tris Hcl] is so much higher.
1X T7 buffer:
400 mM Tris Hcl
8  mM MgCl2
2  mM spermidine-Hcl
25 mM NaCl
PH 7.9

1X NEBNext RNase III Reaction Buffer: 
10 mM Tris-HCl 
10 mM Mg(Cl)2 
1 mM DTT 
60 mM NaCl 
pH 8.3 @ 25°C

10X Poly(A) Polymerase buffer:
500 mM Tris-HCl
2.5 M NaCl
100 mM MgCl2
pH 7.9 @ 25°C

MMLV
Invitrogen (though using clontech)
5X First-Strand Buffer
250 mM Tris-HCl (pH 8.3 at room temperature
375 mM KCl
15 mM MgCl2
0.1 M DTT


Rnase III protocol

1. Retrieve IVT RNA.

  • samples:
IVT sample
control RNA
NTC etc


2. Perform RNase III fragmentation (NEB):

Starting Material: Purified mRNA (50–250 nanograms)

 1. Add 5' end blocking DNA primer and do annealing to form DNA-RNA hybrid.
 *a. add 2 uL of blocking oligo (10 uM) to aliquot RNA sample that will be used in step 2.
 *b. Incubate at 95C for 2 minutes.
 *c. cool to RT at 0.1 C/s


2. Mix the following components in a sterile PCR tube:

 X  uL Purified mRNA + blocking primer (50-250 nanograms)
 1  uL RNase III (1 unit/μl)
 2  uL RNase III Reaction Buffer (10X)
 2  uL Nuclease-Free Water
 add in DNA primer to protect 5' end since don't want degradation??
 _______
 20 uL total volume


3. Incubate in a preheated thermal cycler for 5 minutes at 37°C.

4. Transfer tube to ice.


3. (EtOH clean up OR RNA column purification) OR protease digestion

  • EtOH cleanup
a. Add 80 μl of cold Nuclease-Free water. (brings to 100 ul)

b. Add 3 volumes 100% EtOH, .1 volumes 3M NaOAc, and 1/300 volumes glycol Blue to the solution obtained.
  In this case:
  10   uL NaOAc (mix after adding)
  300  uL  100% EtOH
  1    uL Glycol Blue

c. Chill solution in -80 for 30 minutes, cool centrifuge to 4C

d. Spin at 4C for 20 minutes at max speed. Chill 75% EtOH. 

e. Blue pellet should be visible, Discard supernatent.

f. Wash the pellet with cold 75% EtOH

h. Air dry pellet for up to 10 minutes at room temp to remove residual EtOH

j. Resuspend in appropriate volume in nuclease free H2O.
  • Protease digestion
To each tube, add:
1 uL  Qiagen Protease, for 5 uL reaction 1 uL of .5 for .1 AU final. (stock is 5 AU and diluted 10X. want .5 AU/uL final [])
Incubate: 50C 10 minutes, 70C 20 minutes



4. Poly(A) Addition with polyA polymerase (Enzymatics)

  • enzymatics PolyA polymerase.
1. assemble reaction:
   2 uL 5X SMART MMLV first strand buffer (rather than 10X polyA buffer)
   1 uL polyA enzyme
   1 uL 10 mM ATP
   bring to 10 uL with RNA or w/e

2. Incubate at 37C for 10 minutes

3. Heat inactivate at 70C for 20 minutes. (rui and NEB)



5. single strand synthesis MMLV RT (Clontech)

20 uL reaction

1. Add 2.5 uL 20 uM primer stock to RNA sample. Bring to final volume of 11.5 uL with
   Nuclease free H2O (one from BENG160 class, T20VN_PE_R)

2. heat the mixture to 70C fo 3 minutes.  Immediately cool on ice.

3. Add the following to the reaction.
   4 uL 5X first strand buffer
   2 uL dNTP mix
   2 uL 100 uM DTT
   .5 uL SMART MMLV RT and mix (ADD LAST!!!!!)
  ____
   20 uL total

4. Incuvate at 42C for 60 minutes

5. Terminate the reaction by heating at 70C for 10 minutes



6. second strand synthesis (qPCR) (KAPA)

KAPA SYBR FAST qPCR mix X35 cycles

25 uL KAPA SYBR
4    uL primers, 1 uL F, 1 uL R (T7-top2-PCR or T7-top3-PCR) and (PCR_R.N2Ind[XX] (23,24))
1  uL H2O
20    uL DNA template (use whole RT reaction)

KAPA SYBR cycles:
98C 3min, (98C for 30s, 60C for 30s, 72C for 1 min) X35, 72C for 5 min, 4C forever

  • terminate when curves saturate


7.qiaquick cleanup

  • run on gel or w/e
  • run qiaquick to clean sample before performing qPCR.
    • 6 enzymes from 6 different reactions in there already.

Notes and primers used etc

Stuff used for RNA-seq for BENG160 class

5’ end addition primers

TSO_N10_BC[XX]
[AAGCAGTGGTATCAACGCAGAGdUdU]NNNNNNNNNNTTTAGGrGrGrG
         adatpor1

5'- AAG CAG TGG TAT CAA CGC AGA G/ideoxyU//ideoxyU/ NNN NNN NNN NTT TAG GrGrGrG -3'

P1-STRT
5’- [AATGATACGGCGACCACCGA][GATCT][AAGCAGTGGTATCAACGCAGAGT] -3’  (Tm=82.59)
      ILA adaptor blue Tm=64.31         adaptor1 Tm=61.02

STRT-SEQ
5'- [GATCT][AAGCAGTGGTATCAACGCAGAGTT] -3'
                adaptor1
3’ end addition primers

T20VN_PE_R
5'-Bio-[GCATTCCTGCTGAACCGCTCTT]CCGATCTTTTTTTTTTTTTTTTTTTTTVN  -3’  (Tm=78.92)
          adaptor2 Tm=65.68

PCR_R.N2Ind[XX] (XX=23,24 for me)
5’- [CAAGCAGAAGACGGCATACGAGAT][TACAAG]CTCG][GCATTCCTGCTGAACCGCTCTT] -3’ (Tm=87.12)
        ILA adaptor orange       bc          adaptor2 Tm=65.68
My modifications for T7-tspns for 5' addition primers

5’- [AATGATACGGCGACCACCGA][GATCT][CTCCCTCGCGCCATCAGAGAT]  -3’  (Tm=86.59)
     ILA adaptor blue           Top2-5’end (T7-top2-PCR) Tm=66.79



5’- [AATGATACGGCGACCACCGA][GATCT][GGGAGACATTAAGATGTGTATAAGAGACAG] -3’  (Tm=81.40)
     ILA adaptor blue              Top3-5’end (T7-top3-PCR) Tm=60.71


Mg++ protocol

balh balbh a


blah



ba lbahlb