Noi/NOTES/2014-10-15

From ZhangLabWiki
Revision as of 17:04, 17 October 2014 by >Noi (Created page with "* '''Link to calendar''' * 2014-10-15: Received :90k_oligos_30Sept2014 from CustomArray === Oligo info. === * Name: 90k_oligos_30Sept2014 * Conc. 69....")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Oligo info.

*Sept14 probe set: Media:90k_oligos_30Sept2014.txt.gz
           probe set           # probes    Length             Amp primers                                               
  Chris    gDNA_MS_v2            8,045      127bp  V6(G*T*CATATCGGTCACTGTU//5Phos/GGGTAGTGTGTATCCTG)      
  Kun      cancer_hyb_sept14    51,639  110-130bp  V8(T*C*TAATCTAGCGCGACGTCU//5Phos/CCACAAGAGGCGCTATG)   
  Kun      LMS_selector         17,342  124-130bp  NE(TGCCTAGGACCGGATCAACT/GCTTCGGTTCACGCAATG)           
  Kun      padlock_SNPs         12,974      125bp  V4(G*A*CTGGAAGAGCACTGTU//5Phos/AGCCTCATGCGTATCCG)         
                         Total  90,000
  • Length: I would use the average size of the oligo pool to calculate concentration ~125nt = MW=41250g/mole
  • Conc. : 69.89 ng/ul = 1694.30 (69.89ng/ul/ 41250g/mole)

Expansion PCR (Quick test, round1)

  • I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set)
  • I will include the two positive control for the two primer set to confirm that the amplification works fine.