Noi/NOTES/2014-10-15
Jump to navigation
Jump to search
- Link to calendar
- 2014-10-15: Received :90k_oligos_30Sept2014 from CustomArray
Oligo info.
- Name: 90k_oligos_30Sept2014
- Conc. 69.89ng/ul,
- Volume 80ul in TE buffer. Total amount XXug
- Info from Dr. Zhang's note
*Sept14 probe set: Media:90k_oligos_30Sept2014.txt.gz probe set # probes Length Amp primers Chris gDNA_MS_v2 8,045 127bp V6(G*T*CATATCGGTCACTGTU//5Phos/GGGTAGTGTGTATCCTG) Kun cancer_hyb_sept14 51,639 110-130bp V8(T*C*TAATCTAGCGCGACGTCU//5Phos/CCACAAGAGGCGCTATG) Kun LMS_selector 17,342 124-130bp NE(TGCCTAGGACCGGATCAACT/GCTTCGGTTCACGCAATG) Kun padlock_SNPs 12,974 125bp V4(G*A*CTGGAAGAGCACTGTU//5Phos/AGCCTCATGCGTATCCG) Total 90,000
- Length: I would use the average size of the oligo pool to calculate concentration ~125nt = MW=41250g/mole
- Conc. : 69.89 ng/ul = 1694.30 (69.89ng/ul/ 41250g/mole)
Expansion PCR (Quick test, round1)
- I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set)
- I will include the two positive control for the two primer set to confirm that the amplification works fine.