Matt:LabNotes/2017-5-22

From ZhangLabWiki
Revision as of 01:02, 23 May 2017 by >Mzcai (Created page with "=Fifth Try: in tube SplintR Test with formamide= *[[Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditi...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Fifth Try: in tube SplintR Test with formamide

  • Repeat Fourth Try with 95C 3min denature before hybridization

Test Conditions

  1. Standard: SplintR only
  2. SplintR + 5% formamide
  3. SplintR + 7.5% formamide
  4. SplintR + 10% formamide
  5. SplintR + 12.5% formamide
  6. SplintR + 15% formamide
  7. SplintR + 17.5% formamide
  8. Positive Control: Ampligase
  • For each test conditions have
    • one sample with ALL padlock probes and template
      • Should see amplification
    • one sample with all padlock probes with NO MALAT1 template
      • Should not see amplification

Padlock Probes and Template

  • ppCUX2
  • ppBCL11B
  • ppRELN_1
  • ppGFAP
  • ppMALAT1
    • /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
  • Template for ppMALAT1: MALAT1_template
    • /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT

Protocol

Sample # Condition 30nM PP + Template 10X Buffer Formamide H2O Total
1 SplintR 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 22.5 or 21.6 30
2 SplintR + 5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 1.5 21 or 20.1 30
3 SplintR + 7.5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 2.25 20.25 or 19.35 30
4 SplintR + 10% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 3 19.5 or 18.6 30
5 SplintR + 12.5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 3.75 18.75 or 17.85 30
6 SplintR + 15% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 4.5 18 or 17.1 30
7 SplintR + 17.5 formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 5.25 17.25 or 16.35 30
8 Ampligase 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 22.5 or 21.6 (these were added before realizing wrong volume. Kept as is) 30
  1. Combine padlock probes and template in 1X Ligase buffer and possibly formamide
  2. Add mineral oil on top
  3. Incubate at 95C for 3min
  4. Incubate at 55C for 18hr