Jie:LabNotes/CpgSeq/2009-8-5

From ZhangLabWiki
Revision as of 18:08, 17 August 2009 by >Jie deng
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

shotgun library construction of Parkinson's samples[edit]

The captured DNA of samples were sent to Covaris for shearing.refer to LabNotes on [1] see 1.5.2

endrepair with enzymatic end-repair kit[edit]

                                       x10
100 ul DNA 
 13 ul 10X End-Repair Buffer           130
 13 ul dNTP Mix                        130
  4 ul End-Repair Enzyme Mix            40
130 ul Total reaction volume
Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.

A tail addition[edit]

                                   x11
  Blunt-ended DNA        10ul      10 each
  10X Klenow buffer      1.6ul     17.6
  1mM dATP                3ul      33
  Klenow fragment (exo-)  1ul      11
  37C 30min, purified with MinElute columns, eluted with 12ul EB. 

adaptor ligation[edit]

                                               x12
    DNA                                10ul
    2x QuickLigase buffer (enzymatic)  15ul     180
    20uM Adaptor oligo mix              3ul      36
    T4 DNA QuickLigase (enzymatic)      2ul      24
    Incubate at RT for 15 minutes.
    Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.

PCR[edit]

   Template                5ul        
   2x iProof mix          50ul       
   Solexa_PCR_up (10uM)    4ul        
   Solexa_PCR_lo_PE (10uM) 4ul        
   H2O                     37ul       
   50X SYBG I             0.2ul
98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)-> 
72C 3min -> 15C hold.

File:20090807 shotgun lib Parkinson samples.jpg20090807_shotgun_lib_Parkinson_samples

quantification of shotgun library[edit]

File:20090810 shotgun lib quanti Parkinson No1 9 Phix.jpg20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix

gel quantification results:
Par_1: 6.14ng/ul x 40ul;
Par_9: 7.54ng/ul x 40ul;
PhiX lib: 7.43ng/ul (size 275-325bp)
Nanodrop results:
Par_1: 24.9ng/ul x 40ul;
Par_9: 21.8ng/ul x 40ul;
PhiX lib: 5.9ng/ul

quantification with qPCR[edit]

I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM.
I dilute the Parkinson's lib with 1:10 ratio. 
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
                                    x 14
  Template                 1ul          
  2x iProof mix           25ul        350
  syb_RP7 (100uM)        0.2ul        
  Syb_FP5 (100uM)        0.2ul        
  H2O                     24ul       
  50X SYBG I             0.2ul

98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.

File:20090812 PhiX quantification.png
20090812_Parkinson_sample_quantification
No sample sample concentration
Par_1 5028 12.2nM
Par_2 4735 10.2nM
Par_3 4789 9.3nM
Par_4 5171 6.6nM
Par_5 1818 6.0nM
Par_6 1947 7.8nM
Par_7 1741 6.9nM
Par_8 4977 9.6nM
Par_9 4879 5.5nM
Par_10 4526 6.6nM