Jie:LabNotes/CpgSeq/2009-8-5
Jump to navigation
Jump to search
shotgun library construction of Parkinson's samples[edit]
The captured DNA of samples were sent to Covaris for shearing.refer to LabNotes on [1] see 1.5.2
endrepair with enzymatic end-repair kit[edit]
x10 100 ul DNA 13 ul 10X End-Repair Buffer 130 13 ul dNTP Mix 130 4 ul End-Repair Enzyme Mix 40 130 ul Total reaction volume Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.
A tail addition[edit]
x11 Blunt-ended DNA 10ul 10 each 10X Klenow buffer 1.6ul 17.6 1mM dATP 3ul 33 Klenow fragment (exo-) 1ul 11 37C 30min, purified with MinElute columns, eluted with 12ul EB.
adaptor ligation[edit]
x12 DNA 10ul 2x QuickLigase buffer (enzymatic) 15ul 180 20uM Adaptor oligo mix 3ul 36 T4 DNA QuickLigase (enzymatic) 2ul 24 Incubate at RT for 15 minutes. Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.
PCR[edit]
Template 5ul 2x iProof mix 50ul Solexa_PCR_up (10uM) 4ul Solexa_PCR_lo_PE (10uM) 4ul H2O 37ul 50X SYBG I 0.2ul 98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)-> 72C 3min -> 15C hold.
File:20090807 shotgun lib Parkinson samples.jpg20090807_shotgun_lib_Parkinson_samples
quantification of shotgun library[edit]
File:20090810 shotgun lib quanti Parkinson No1 9 Phix.jpg20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix
gel quantification results: Par_1: 6.14ng/ul x 40ul; Par_9: 7.54ng/ul x 40ul; PhiX lib: 7.43ng/ul (size 275-325bp)
Nanodrop results: Par_1: 24.9ng/ul x 40ul; Par_9: 21.8ng/ul x 40ul; PhiX lib: 5.9ng/ul
quantification with qPCR[edit]
I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM. I dilute the Parkinson's lib with 1:10 ratio. Syb_FP5: ATGATACGGCGACCACCGAG Syb_RP7: CAAGCAGAAGACGGCATACGAG x 14 Template 1ul 2x iProof mix 25ul 350 syb_RP7 (100uM) 0.2ul Syb_FP5 (100uM) 0.2ul H2O 24ul 50X SYBG I 0.2ul
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
File:20090812 PhiX quantification.png
20090812_Parkinson_sample_quantification
No | sample | sample concentration |
Par_1 | 5028 | 12.2nM |
Par_2 | 4735 | 10.2nM |
Par_3 | 4789 | 9.3nM |
Par_4 | 5171 | 6.6nM |
Par_5 | 1818 | 6.0nM |
Par_6 | 1947 | 7.8nM |
Par_7 | 1741 | 6.9nM |
Par_8 | 4977 | 9.6nM |
Par_9 | 4879 | 5.5nM |
Par_10 | 4526 | 6.6nM |