Alice:LabNotes/2010-3-8
Jump to navigation
Jump to search
Prepare genomic DNA for hybridization
- samples to be prepared: CVF-gDNA, CViB-gDNA,
- two sheared gDNA received from Harvard: CD1 PGP1 ips P16 and PGP1F 8 gDNA
End-repair Reactions
Fragmented DNA 85 ul 10X End Repair Reaction Buffer 10 ul End Repair Enzyme Mix 5 ul Keep the tube at room temperature (~20°C) for 30 minutes. Purify with Qiaquick column and elute in 40ul ddH2O Note: for blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the chance of getting chimeric reads.
A-Tailing reactions
Blunt-end DNA 37 ul 10X dA-Tailing Reaction Buffer (10X) 5 ul Klenow Fragment (3’-5’ exo-) 3 ul H2O 5 ul Incubated at 37C for 30min purified the products with Qiaquick column and elute in 40ul ddH2O
adaptor ligation
Prepare adaptors (need to be done only for the first time): 100uM PE-t: 20ul 100uM PE-b: 20ul 10x stoffel buffer: 10ul H2O: 50ul 94C for 3 min, and then cool down to 20C at the rate of 0.1C/sec.
commonly used adaptors: Blunt-end adaptors: 5’NH2- ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’OH Solexa_1_up 3’NH2-ATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-5’OH Solexa_1_lo_nop TA adaptors (for the one adaptor protocol): 5- CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3’OH PE_t_adapter 3-CTTCTGCCGTATGCTCGAGAAGGCTAG-5’Phos t_adaptor_rc_s regular Y adaptor: PE_t_adaptor(top) ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3'-Phosphorothioate bond PE_b_adaptor(bottom) \\5phos\\GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 5'-phosphorylation
Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time. adaptor:target molar ratio is 1:10~20 A-tailed DNA 10 ul 20uM Y adaptor 3 ul 5X Quick ligase buffer 10 ul Quick Ligase 3 ul H2O 24 ul
Incubate at room temperature for 15 minutes purify the product with Agencourt AMpure kit and elute in 40ul ddH2O
PCR
Ligation products 5ul (8 well for each set, total of 80 well) 100uM Solexa_PCR_up 0.2ul 100uM solexa_PCR-lo 0.2ul 2X phusion HF master mix 50ul 50X SYBR Green I 0.4ul H2O 45ul PCR program: 98 °C 30sec -> 13 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold. purify the products with Qiagen Qiaquick columns and elute in 40ul ddH2O