Matt:LabNotes/2013-7-1

From ZhangLabWiki
Revision as of 19:06, 1 July 2013 by >Mzcai (Created page with "====Amplification with Sequencing Adapters==== *Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007) **[[Media:probe2padlockFISSEQ_2...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Amplification with Sequencing Adapters

  • Since this is the same design as LC Sciences probes that Noi used, I'll use the same primers
 Program
 *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold