Matt:LabNotes/2013-7-1
Jump to navigation
Jump to search
Amplification with Sequencing Adapters
- Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007)
- Since this is the same design as LC Sciences probes that Noi used, I'll use the same primers
Program *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold