Matt:LabNotes/2013-7-1
Jump to navigation
Jump to search
Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-6-28
Amplification with Sequencing Adapters
- Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007)
- Since this is the same design as LC Sciences probes that Noi used, I'll use the same primers
Tube # | Sample | Index# |
1 | NTC-0gap | Indx7 |
2 | gDNA-0gap | Indx45 |
3 | cDNA-0gap | Indx76 |
4 | NTC-20gap | Indx7 |
5 | gDNA-20gap | Indx77 |
6 | cDNA-20gap | Indx78 |
Will also do duplicate for each sample so 12 reactions total
Components | 1 rxn | 13 rxn |
Captured template | 12.00 | 0.00 |
10uM Forward+Indx | 2.00 | 0.00 |
10uM Reverse | 2.00 | 26.00 |
2x KAPA SYBG fast MM | 50.00 | 650.00 |
H2O | 34.00 | 442.00 |
Total | 100.00 | 1300.00 |
Program *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold
File:07012013 Agi26kCapturedSequencePCRGraph.JPG
- Sample with greatest amplification is NTC for 20gap probes
- Will run a gel to see what is causing the signal
- Both 20gap samples did not show amplification suggesting something went wrong
- Possibly the dNTP mix used during capture reaction is to blame because Noi says the Stoffel fragment enzyme was working a week ago
- Both 0gap samples showed moderate amplification and NTC was as expected