Matt:LabNotes/2013-7-11
Jump to navigation
Jump to search
Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-7-9
Amplification with Sequencing Adapters
- Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007)
Tube # | Sample | Index# |
1 | NTC-Agi26k_20gap | Indx7 |
2 | gDNA-Agi26k_20gap | Indx77 |
3 | cDNA-Agi26k_20gap | Indx78 |
4 | gDNA-CES36k18bp | Indx48 |
Components | 1X Reaction | 5X Reaction |
Captured Template | 1 | 0 |
10uM Forward + Indx | 0.4 | 0 |
10uM Reverse | 0.4 | 2.0 |
2X KAPA SYBG FAST MM | 12.5 | 62.5 |
H2O | 10.7 | 53.5 |
Total | 25 | 125 |
Program *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x16 cycles -> 72°C 3 min -> 15°C hold