Matt:LabNotes/2013-7-19

From ZhangLabWiki
Revision as of 21:27, 22 July 2013 by >Mzcai
Jump to navigation Jump to search

Analysis of HL155: Representation Bias of Agi26k Oligos

  • Previously amplified Agi26k oligos with sequence adapters to sequence
  • By counting the number of reads for each probe, can determine uniformity of oligos in probe set
  1. Turn FISSEQ_Probes_Dec2012.txt into fasta file (Full: Agi26kprobes_to_order.fa 50bp: Agi26kprobes_to_order_50bp.fa)
    1. First Primer for V6: "GTCATATCGGTCACTGTT"
    2. First Primer for V4: "TAGACTGGAAGAGCACTGTT"
  2. Build index for probes
    1. /home/kunzhang/softwares/bowtie2-latest/bowtie2-build ~/InSitu_HL155_130628_Analysis/Agi26kprobes_to_order.fa Agi26kprobes
    2. /home/kunzhang/softwares/bowtie2-latest/bowtie2-build ~/InSitu_HL155_130628_Analysis/Agi26kprobes_to_order_50bp.fa Agi26kprobes_50bp
  3. Align to index
    1. Indx10 -> 0 gap -> V6:
      1. /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx10.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_0gapFull.txt &
        16368416 reads; of these:
        16368416 (100.00%) were unpaired; of these:
        8915822 (54.47%) aligned 0 times
        7452594 (45.53%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
        45.53% overall alignment rate
      2. /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes_50bp -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx10.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_0gap50bp.txt &
        mzcai@genome-miner:~/InSitu_HL155_130628_Analysis$ 16368416 reads; of these:
        16368416 (100.00%) were unpaired; of these:
        15978678 (97.62%) aligned 0 times
        389738 (2.38%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
        2.38% overall alignment rate
    2. Indx12 -> 20 gap -> V4:
      1. /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx12.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_20gapFull.txt &
        mzcai@genome-miner:~/InSitu_HL155_130628_Analysis$ 17308686 reads; of these:
        17308686 (100.00%) were unpaired; of these:
        11482192 (66.34%) aligned 0 times
        5826494 (33.66%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
        33.66% overall alignment rate
      2. /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes_50bp -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx12.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_20gap50bp.txt &
        mzcai@genome-miner:~/InSitu_HL155_130628_Analysis$ 17308686 reads; of these:
        17308686 (100.00%) were unpaired; of these:
        17112441 (98.87%) aligned 0 times
        196245 (1.13%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
        1.13% overall alignment rate
  4. Counts for each probe: CountsofAgi26k_0gap50bp.txt, CountsofAgi26k_0gapFull.txt, CountsofAgi26k_20gap50bp.txt, CountsofAgi26k_20gapFull.txt
    1. Counts aren't zero where expected...