Matt:LabNotes/2013-7-19
Jump to navigation
Jump to search
Analysis of HL155: Representation Bias of Agi26k Oligos
- Previously amplified Agi26k oligos with sequence adapters to sequence
- By counting the number of reads for each probe, can determine uniformity of oligos in probe set
- Turn FISSEQ_Probes_Dec2012.txt into fasta file (Full: Agi26kprobes_to_order.fa 50bp: Agi26kprobes_to_order_50bp.fa)
- First Primer for V6: "GTCATATCGGTCACTGTT"
- First Primer for V4: "TAGACTGGAAGAGCACTGTT"
- Build index for probes
- /home/kunzhang/softwares/bowtie2-latest/bowtie2-build ~/InSitu_HL155_130628_Analysis/Agi26kprobes_to_order.fa Agi26kprobes
- /home/kunzhang/softwares/bowtie2-latest/bowtie2-build ~/InSitu_HL155_130628_Analysis/Agi26kprobes_to_order_50bp.fa Agi26kprobes_50bp
- Align to index
- Indx10 -> 0 gap -> V6:
- /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx10.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_0gapFull.txt &
16368416 reads; of these:
16368416 (100.00%) were unpaired; of these:
8915822 (54.47%) aligned 0 times
7452594 (45.53%) aligned exactly 1 time
0 (0.00%) aligned >1 times
45.53% overall alignment rate - /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes_50bp -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx10.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_0gap50bp.txt &
mzcai@genome-miner:~/InSitu_HL155_130628_Analysis$ 16368416 reads; of these:
16368416 (100.00%) were unpaired; of these:
15978678 (97.62%) aligned 0 times
389738 (2.38%) aligned exactly 1 time
0 (0.00%) aligned >1 times
2.38% overall alignment rate
- /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx10.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_0gapFull.txt &
- Indx12 -> 20 gap -> V4:
- /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx12.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_20gapFull.txt &
mzcai@genome-miner:~/InSitu_HL155_130628_Analysis$ 17308686 reads; of these:
17308686 (100.00%) were unpaired; of these:
11482192 (66.34%) aligned 0 times
5826494 (33.66%) aligned exactly 1 time
0 (0.00%) aligned >1 times
33.66% overall alignment rate - /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes_50bp -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx12.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_20gap50bp.txt &
mzcai@genome-miner:~/InSitu_HL155_130628_Analysis$ 17308686 reads; of these:
17308686 (100.00%) were unpaired; of these:
17112441 (98.87%) aligned 0 times
196245 (1.13%) aligned exactly 1 time
0 (0.00%) aligned >1 times
1.13% overall alignment rate
- /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx12.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_20gapFull.txt &
- Indx10 -> 0 gap -> V6:
- Counts for each probe: CountsofAgi26k_0gap50bp.txt, CountsofAgi26k_0gapFull.txt, CountsofAgi26k_20gap50bp.txt, CountsofAgi26k_20gapFull.txt
- Counts aren't zero where expected...