Matt:LabNotes/2013-7-19

From ZhangLabWiki
Revision as of 21:59, 22 July 2013 by >Mzcai
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Analysis of HL155: Representation Bias of Agi26k Oligos[edit]

  • Previously amplified Agi26k oligos with sequence adapters to sequence
  • By counting the number of reads for each probe, can determine uniformity of oligos in probe set
  1. Turn FISSEQ_Probes_Dec2012.txt into fasta file (Full: Agi26kprobes_to_order.fa 50bp: Agi26kprobes_to_order_50bp.fa)
    1. First Primer for V6: "GTCATATCGGTCACTGTT"
    2. First Primer for V4: "TAGACTGGAAGAGCACTGTT"
  2. Build index for probes
    1. /home/kunzhang/softwares/bowtie2-latest/bowtie2-build ~/InSitu_HL155_130628_Analysis/Agi26kprobes_to_order.fa Agi26kprobes
    2. /home/kunzhang/softwares/bowtie2-latest/bowtie2-build ~/InSitu_HL155_130628_Analysis/Agi26kprobes_to_order_50bp.fa Agi26kprobes_50bp
  3. Align to index
    1. Indx10 -> 0 gap -> V6:
      1. /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx10.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_0gapFull.txt &
        16368416 reads; of these:
        16368416 (100.00%) were unpaired; of these:
        8915822 (54.47%) aligned 0 times
        7452594 (45.53%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
        45.53% overall alignment rate
      2. /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes_50bp -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx10.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_0gap50bp.txt &
        mzcai@genome-miner:~/InSitu_HL155_130628_Analysis$ 16368416 reads; of these:
        16368416 (100.00%) were unpaired; of these:
        15978678 (97.62%) aligned 0 times
        389738 (2.38%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
        2.38% overall alignment rate
    2. Indx12 -> 20 gap -> V4:
      1. /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx12.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_20gapFull.txt &
        mzcai@genome-miner:~/InSitu_HL155_130628_Analysis$ 17308686 reads; of these:
        17308686 (100.00%) were unpaired; of these:
        11482192 (66.34%) aligned 0 times
        5826494 (33.66%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
        33.66% overall alignment rate
      2. /home/kunzhang/softwares/bowtie2-latest/bowtie2 -k 1 --phred64 --mp 1,0 --rdg 0,1 --rfg 0,1 -x /home/mzcai/InSitu_HL155_130628_Analysis/Agi26kprobes_50bp -q /home/mzcai/InSitu_HL155_130628_Analysis/s_3_1_Indx12.txt > /home/mzcai/InSitu_HL155_130628_Analysis/Readsalign2probes_20gap50bp.txt &
        mzcai@genome-miner:~/InSitu_HL155_130628_Analysis$ 17308686 reads; of these:
        17308686 (100.00%) were unpaired; of these:
        17112441 (98.87%) aligned 0 times
        196245 (1.13%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
        1.13% overall alignment rate
  4. Counts for each probe: CountsofAgi26k_0gap50bp.txt, CountsofAgi26k_0gapFull.txt, CountsofAgi26k_20gap50bp.txt, CountsofAgi26k_20gapFull.txt
    1. Many 0 gap reads aligned to 20 gap probes and vice versa suggests this method isn't specific enough

Below is number of probes binned into number of reads for 50bp reference probes

0 gap reads aligned to 0 gap probe ' 0 gap reads aligned to 20 gap probes ' 20 gap reads aligned to 0 gap probes ' 20 gap reads aligned to 20 gap probes '
Bin Frequency Bin Frequency Bin Frequency Bin Frequency
0 19 0 1317 0 4034 0 5
7.157894737 293 19.10619469 11167 3.929824561 7384 9.902654867 4268
14.31578947 1427 38.21238938 310 7.859649123 1185 19.80530973 7286
21.47368421 3791 57.31858407 73 11.78947368 289 29.7079646 1191
28.63157895 4282 76.42477876 31 15.71929825 135 39.61061947 111
35.78947368 2293 95.53097345 20 19.64912281 57 49.51327434 37
42.94736842 783 114.6371681 12 23.57894737 30 59.4159292 19
50.10526316 186 133.7433628 8 27.50877193 20 69.31858407 13
57.26315789 37 152.8495575 2 31.43859649 8 79.22123894 8
64.42105263 12 171.9557522 3 35.36842105 4 89.12389381 4
71.57894737 19 191.0619469 1 39.29824561 4 99.02654867 3
78.73684211 8 210.1681416 3 43.22807018 6 108.9292035 0
85.89473684 10 229.2743363 2 47.15789474 3 118.8318584 1
93.05263158 6 248.380531 3 51.0877193 0 128.7345133 2
100.2105263 4 267.4867257 1 55.01754386 0 138.6371681 2
107.3684211 1 286.5929204 1 58.94736842 3 148.539823 0
114.5263158 1 305.699115 0 62.87719298 1 158.4424779 5
121.6842105 1 324.8053097 1 66.80701754 0 168.3451327 1
128.8421053 0 343.9115044 1 70.73684211 3 178.2477876 0
136 0 363.0176991 0 74.66666667 0 188.1504425 0
143.1578947 0 382.1238938 1 78.59649123 0 198.0530973 0
150.3157895 0 401.2300885 0 82.52631579 0 207.9557522 0
157.4736842 0 420.3362832 0 86.45614035 0 217.8584071 1
164.6315789 0 439.4424779 1 90.38596491 1 227.7610619 0
171.7894737 1 458.5486726 0 94.31578947 0 237.6637168 0
178.9473684 0 477.6548673 0 98.24561404 0 247.5663717 0
186.1052632 1 496.7610619 0 102.1754386 0 257.4690265 1
193.2631579 0 515.8672566 0 106.1052632 1 267.3716814 1
200.4210526 0 534.9734513 0 110.0350877 1 277.2743363 0
207.5789474 0 554.079646 0 113.9649123 0 287.1769912 0
214.7368421 0 573.1858407 1 117.8947368 1 297.079646 0
221.8947368 0 592.2920354 0 121.8245614 2 306.9823009 0
229.0526316 0 611.3982301 0 125.754386 1 316.8849558 0
236.2105263 0 630.5044248 0 129.6842105 0 326.7876106 0
243.3684211 0 649.6106195 1 133.6140351 0 336.6902655 1
250.5263158 0 668.7168142 0 137.5438596 0 346.5929204 0
257.6842105 0 687.8230088 0 141.4736842 1 356.4955752 0
264.8421053 1 706.9292035 0 145.4035088 0 366.3982301 0
272 0 726.0353982 0 149.3333333 0 376.300885 0
279.1578947 0 745.1415929 0 153.2631579 1 386.2035398 0
286.3157895 0 764.2477876 0 157.1929825 2 396.1061947 0
293.4736842 0 783.3539823 0 161.122807 0 406.0088496 0
300.6315789 0 802.460177 0 165.0526316 0 415.9115044 0
307.7894737 0 821.5663717 0 168.9824561 0 425.8141593 0
314.9473684 0 840.6725664 0 172.9122807 0 435.7168142 0
322.1052632 0 859.7787611 0 176.8421053 0 445.619469 0
329.2631579 0 878.8849558 0 180.7719298 0 455.5221239 0
336.4210526 0 897.9911504 0 184.7017544 1 465.4247788 0
343.5789474 1 917.0973451 0 188.6315789 0 475.3274336 0
350.7368421 0 936.2035398 0 192.5614035 0 485.2300885 0
357.8947368 0 955.3097345 0 196.4912281 0 495.1327434 0
365.0526316 0 974.4159292 0 200.4210526 0 505.0353982 0
372.2105263 0 993.5221239 0 204.3508772 0 514.9380531 0
379.3684211 0 1012.628319 0 208.2807018 0 524.840708 0
386.5263158 0 1031.734513 0 212.2105263 0 534.7433628 0
393.6842105 1 1050.840708 0 216.1403509 0 544.6460177 0
400.8421053 0 1069.946903 0 220.0701754 0 554.5486726 0
408 0 1089.053097 0 224 0 564.4513274 1
415.1578947 0 1108.159292 0 227.9298246 0 574.3539823 0
422.3157895 0 1127.265487 0 231.8596491 0 584.2566372 0
429.4736842 0 1146.371681 1 235.7894737 0 594.159292 0
436.6315789 0 1165.477876 0 239.7192982 0 604.0619469 0
443.7894737 0 1184.584071 0 243.6491228 0 613.9646018 0
450.9473684 0 1203.690265 0 247.5789474 0 623.8672566 0
458.1052632 0 1222.79646 0 251.5087719 0 633.7699115 0
465.2631579 0 1241.902655 0 255.4385965 0 643.6725664 0
472.4210526 0 1261.00885 0 259.3684211 0 653.5752212 0
479.5789474 0 1280.115044 0 263.2982456 0 663.4778761 0
486.7368421 0 1299.221239 0 267.2280702 0 673.380531 0
493.8947368 0 1318.327434 0 271.1578947 0 683.2831858 0
501.0526316 0 1337.433628 0 275.0877193 0 693.1858407 0
508.2105263 0 1356.539823 0 279.0175439 0 703.0884956 0
515.3684211 0 1375.646018 0 282.9473684 0 712.9911504 0
522.5263158 0 1394.752212 0 286.877193 0 722.8938053 0
529.6842105 0 1413.858407 0 290.8070175 0 732.7964602 0
536.8421053 0 1432.964602 0 294.7368421 0 742.699115 0
544 0 1452.070796 0 298.6666667 0 752.6017699 0
551.1578947 0 1471.176991 0 302.5964912 0 762.5044248 0
558.3157895 0 1490.283186 0 306.5263158 0 772.4070796 0
565.4736842 0 1509.389381 0 310.4561404 0 782.3097345 1
572.6315789 0 1528.495575 0 314.3859649 0 792.2123894 0
579.7894737 0 1547.60177 0 318.3157895 0 802.1150442 0
586.9473684 0 1566.707965 0 322.245614 0 812.0176991 0
594.1052632 0 1585.814159 0 326.1754386 0 821.920354 0
601.2631579 0 1604.920354 0 330.1052632 0 831.8230088 0
608.4210526 0 1624.026549 0 334.0350877 0 841.7256637 0
615.5789474 0 1643.132743 0 337.9649123 0 851.6283186 0
622.7368421 0 1662.238938 0 341.8947368 0 861.5309735 0
629.8947368 0 1681.345133 0 345.8245614 0 871.4336283 0
637.0526316 0 1700.451327 0 349.754386 0 881.3362832 0
644.2105263 0 1719.557522 0 353.6842105 0 891.2389381 0
651.3684211 0 1738.663717 0 357.6140351 0 901.1415929 0
658.5263158 0 1757.769912 0 361.5438596 0 911.0442478 0
665.6842105 0 1776.876106 0 365.4736842 0 920.9469027 0
672.8421053 0 1795.982301 0 369.4035088 0 930.8495575 0
680 0 1815.088496 0 373.3333333 0 940.7522124 0
687.1578947 0 1834.19469 0 377.2631579 0 950.6548673 0
694.3157895 0 1853.300885 1 381.1929825 0 960.5575221 0
701.4736842 0 1872.40708 0 385.122807 0 970.460177 0
708.6315789 0 1891.513274 0 389.0526316 0 980.3628319 0
715.7894737 0 1910.619469 0 392.9824561 0 990.2654867 0
722.9473684 0 1929.725664 0 396.9122807 0 1000.168142 0
730.1052632 0 1948.831858 0 400.8421053 0 1010.070796 0
737.2631579 0 1967.938053 0 404.7719298 0 1019.973451 0
744.4210526 0 1987.044248 0 408.7017544 0 1029.876106 0
751.5789474 0 2006.150442 0 412.6315789 0 1039.778761 0
758.7368421 0 2025.256637 0 416.5614035 0 1049.681416 0
765.8947368 0 2044.362832 0 420.4912281 0 1059.584071 0
773.0526316 0 2063.469027 0 424.4210526 0 1069.486726 0
780.2105263 0 2082.575221 0 428.3508772 0 1079.389381 0
787.3684211 0 2101.681416 0 432.2807018 0 1089.292035 0
794.5263158 0 2120.787611 0 436.2105263 0 1099.19469 0
801.6842105 0 2139.893805 0 440.1403509 0 1109.097345 0
808.8421053 0 More 1 444.0701754 0 More 1
More 1 More 1

Below is number of probes binned into number of reads for full reference probes

0 gap reads aligned to 0 gap probe ' 0 gap reads aligned to 20 gap probes ' 20 gap reads aligned to 0 gap probes ' 20 gap reads aligned to 20 gap probes '
Bin Frequency Bin Frequency Bin Frequency Bin Frequency
1 1 0 26 0 98 20 1
14.92982456 80 10.94690265 3858 15.01754386 7662 38.48672566 1
28.85964912 42 21.89380531 3605 30.03508772 2922 56.97345133 5
42.78947368 31 32.84070796 1623 45.05263158 1150 75.46017699 9
56.71929825 26 43.78761062 999 60.07017544 484 93.94690265 16
70.64912281 18 54.73451327 761 75.0877193 231 112.4336283 13
84.57894737 12 65.68141593 496 90.10526316 135 130.920354 15
98.50877193 7 76.62831858 354 105.122807 82 149.4070796 19
112.4385965 11 87.57522124 270 120.1403509 39 167.8938053 15
126.3684211 7 98.52212389 204 135.1578947 24 186.380531 20
140.2982456 6 109.4690265 141 150.1754386 20 204.8672566 34
154.2280702 9 120.4159292 106 165.1929825 13 223.3539823 57
168.1578947 3 131.3628319 78 180.2105263 7 241.840708 62
182.0877193 8 142.3097345 74 195.2280702 4 260.3274336 135
196.0175439 9 153.2566372 54 210.245614 9 278.8141593 195
209.9473684 12 164.2035398 39 225.2631579 11 297.300885 328
223.877193 14 175.1504425 33 240.2807018 9 315.7876106 458
237.8070175 16 186.0973451 31 255.2982456 3 334.2743363 664
251.7368421 14 197.0442478 10 270.3157895 11 352.7610619 731
265.6666667 21 207.9911504 13 285.3333333 2 371.2477876 991
279.5964912 34 218.9380531 14 300.3508772 11 389.7345133 1022
293.5263158 37 229.8849558 11 315.3684211 12 408.2212389 1133
307.4561404 44 240.8318584 16 330.3859649 16 426.7079646 1077
321.3859649 73 251.7787611 8 345.4035088 22 445.1946903 1074
335.3157895 83 262.7256637 9 360.4210526 14 463.6814159 993
349.245614 122 273.6725664 11 375.4385965 34 482.1681416 887
363.1754386 145 284.619469 9 390.4561404 23 500.6548673 682
377.1052632 199 295.5663717 6 405.4736842 19 519.1415929 601
391.0350877 220 306.5132743 7 420.4912281 23 537.6283186 433
404.9649123 276 317.460177 5 435.5087719 25 556.1150442 342
418.8947368 343 328.4070796 5 450.5263158 11 574.6017699 249
432.8245614 438 339.3539823 3 465.5438596 6 593.0884956 182
446.754386 460 350.300885 1 480.5614035 4 611.5752212 145
460.6842105 562 361.2477876 0 495.5789474 9 630.0619469 95
474.6140351 580 372.1946903 5 510.5964912 12 648.5486726 70
488.5438596 612 383.1415929 4 525.6140351 3 667.0353982 43
502.4736842 678 394.0884956 3 540.6315789 6 685.5221239 47
516.4035088 608 405.0353982 2 555.6491228 2 704.0088496 32
530.3333333 715 415.9823009 0 570.6666667 2 722.4955752 22
544.2631579 626 426.9292035 1 585.6842105 0 740.9823009 19
558.1929825 702 437.8761062 2 600.7017544 4 759.4690265 13
572.122807 664 448.8230088 2 615.7192982 1 777.9557522 6
586.0526316 628 459.7699115 1 630.7368421 0 796.4424779 6
599.9824561 502 470.7168142 7 645.754386 1 814.9292035 4
613.9122807 456 481.6637168 6 660.7719298 1 833.4159292 2
627.8421053 480 492.6106195 1 675.7894737 0 851.9026549 1
641.7719298 363 503.5575221 2 690.8070175 0 870.3893805 4
655.7017544 319 514.5044248 1 705.8245614 0 888.8761062 1
669.6315789 258 525.4513274 0 720.8421053 0 907.3628319 1
683.5614035 276 536.3982301 0 735.8596491 0 925.8495575 1
697.4912281 215 547.3451327 3 750.877193 0 944.3362832 1
711.4210526 199 558.2920354 4 765.8947368 0 962.8230088 1
725.3508772 159 569.2389381 2 780.9122807 0 981.3097345 1
739.2807018 119 580.1858407 2 795.9298246 0 999.7964602 0
753.2105263 126 591.1327434 2 810.9473684 0 1018.283186 1
767.1403509 71 602.079646 4 825.9649123 1 1036.769912 0
781.0701754 83 613.0265487 0 840.9824561 0 1055.256637 0
795 48 623.9734513 3 856 0 1073.743363 0
808.9298246 28 634.920354 1 871.0175439 0 1092.230088 0
822.8596491 32 645.8672566 2 886.0350877 0 1110.716814 0
836.7894737 30 656.8141593 2 901.0526316 0 1129.20354 0
850.7192982 29 667.7610619 3 916.0701754 0 1147.690265 0
864.6491228 22 678.7079646 3 931.0877193 0 1166.176991 0
878.5789474 23 689.6548673 0 946.1052632 0 1184.663717 0
892.5087719 15 700.6017699 1 961.122807 0 1203.150442 1
906.4385965 11 711.5486726 3 976.1403509 0 1221.637168 0
920.3684211 9 722.4955752 2 991.1578947 0 1240.123894 0
934.2982456 8 733.4424779 3 1006.175439 0 1258.610619 0
948.2280702 8 744.3893805 0 1021.192982 0 1277.097345 0
962.1578947 9 755.3362832 1 1036.210526 0 1295.584071 0
976.0877193 5 766.2831858 1 1051.22807 0 1314.070796 0
990.0175439 7 777.2300885 0 1066.245614 0 1332.557522 1
1003.947368 5 788.1769912 2 1081.263158 0 1351.044248 0
1017.877193 2 799.1238938 1 1096.280702 0 1369.530973 0
1031.807018 0 810.0707965 0 1111.298246 0 1388.017699 0
1045.736842 5 821.0176991 0 1126.315789 0 1406.504425 0
1059.666667 2 831.9646018 0 1141.333333 0 1424.99115 0
1073.596491 2 842.9115044 0 1156.350877 0 1443.477876 0
1087.526316 2 853.8584071 0 1171.368421 0 1461.964602 0
1101.45614 3 864.8053097 0 1186.385965 0 1480.451327 0
1115.385965 3 875.7522124 0 1201.403509 0 1498.938053 0
1129.315789 3 886.699115 0 1216.421053 0 1517.424779 0
1143.245614 0 897.6460177 0 1231.438596 0 1535.911504 0
1157.175439 3 908.5929204 0 1246.45614 0 1554.39823 0
1171.105263 3 919.539823 0 1261.473684 0 1572.884956 0
1185.035088 2 930.4867257 0 1276.491228 0 1591.371681 0
1198.964912 2 941.4336283 0 1291.508772 0 1609.858407 0
1212.894737 2 952.380531 0 1306.526316 0 1628.345133 0
1226.824561 4 963.3274336 0 1321.54386 0 1646.831858 0
1240.754386 7 974.2743363 0 1336.561404 0 1665.318584 0
1254.684211 2 985.2212389 0 1351.578947 0 1683.80531 0
1268.614035 2 996.1681416 0 1366.596491 0 1702.292035 0
1282.54386 4 1007.115044 0 1381.614035 0 1720.778761 0
1296.473684 2 1018.061947 0 1396.631579 0 1739.265487 0
1310.403509 0 1029.00885 0 1411.649123 0 1757.752212 0
1324.333333 1 1039.955752 0 1426.666667 0 1776.238938 0
1338.263158 1 1050.902655 0 1441.684211 0 1794.725664 0
1352.192982 0 1061.849558 0 1456.701754 0 1813.212389 0
1366.122807 1 1072.79646 0 1471.719298 0 1831.699115 0
1380.052632 1 1083.743363 0 1486.736842 0 1850.185841 0
1393.982456 2 1094.690265 0 1501.754386 0 1868.672566 0
1407.912281 0 1105.637168 0 1516.77193 0 1887.159292 0
1421.842105 2 1116.584071 0 1531.789474 0 1905.646018 0
1435.77193 1 1127.530973 0 1546.807018 0 1924.132743 0
1449.701754 0 1138.477876 0 1561.824561 0 1942.619469 0
1463.631579 1 1149.424779 0 1576.842105 0 1961.106195 0
1477.561404 1 1160.371681 0 1591.859649 0 1979.59292 0
1491.491228 0 1171.318584 0 1606.877193 0 1998.079646 0
1505.421053 0 1182.265487 0 1621.894737 0 2016.566372 0
1519.350877 0 1193.212389 0 1636.912281 0 2035.053097 0
1533.280702 0 1204.159292 0 1651.929825 0 2053.539823 0
1547.210526 0 1215.106195 0 1666.947368 0 2072.026549 0
1561.140351 1 1226.053097 0 1681.964912 0 2090.513274 0
1575.070175 0 More 1 1696.982456 0 More 1
More 1 More 1