Brandon:LabNotes/Project1/2013-12-3

From ZhangLabWiki
Revision as of 21:07, 3 December 2013 by >Bsos (Created page with "==Transposon for single cell accessibility== *Know that transposon works well for 1000 cells and produces alot of RNA product after IVT amplification. However there are limi...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Transposon for single cell accessibility

  • Know that transposon works well for 1000 cells and produces alot of RNA product after IVT amplification. However there are limitations to amplification by IVT, as ~400 pg of DNA is needed for amplification by IVT. To try and overcome this limitation, single cells can be barcoded upon tranposition, then pooled for IVT amplification.
    • no cleaning steps required
    • dilute transposome, found can still work well with 8X dilution. (still waiting for sequencing results on other dilution. However this is for 500 cells.





  • Tested IVT amplification on 50 cells and found enough RNA (~50 ng is generated to perform the barcoding reaction). however since barcoding is already done, downstream processing will be different.
  • Thus 50-100 cells pooled after barcoding looks feasible.


  • Possible issues
    • loss of product when pooling samples. more efficient way to pool?
    • Need to use DNA lo-bind tubes
    • T4 ligation efficiency?


Single cell transposon design

sc-ME-top
GCGCCATCAG][AGATGTGTATAAGAGACAG]

sc-ME-bottom
TAGGAGGGAG|CGCGGTAGTC][TCTACACATATTCTCTGTC]

sc-T7-R1-Idx49
[AAATTAATACGACTCACTATAGGGAGA][TTCTCGCCAAGTCGTCCTTACGGCTC][BARCOD][ATCCTCCCTC


Complete sequence of transposome after ligation

  T7 consensus sequence (27)       N2 Index seq (26)       (6)    for ligation/R1 (20)     ME end (19)
[AAATTAATACGACTCACTATAGGGAGA][TTCTCGCCAAGTCGTCCTTACGGCTC][BARCOD][ATCCTCCCTC|GCGCCATCAG][AGATGTGTATAAGAGACAG]


After annealing 
sc-ME-annealed
           GCGCCATCAG][AGATGTGTATAAGAGACAG]  sc-ME-top
TAGGAGGGAG|CGCGGTAGTC][TCTACACATATTCTCTGTC]  sc-ME-bottom


After ligation with T4 (amp ligase?)