Noi/NOTES/2014-4-21

From ZhangLabWiki
Revision as of 10:26, 27 April 2014 by >Noi (→‎Results)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

scRRBS experiment: Apr#1[edit]

Link to calendar: [[1]]

  • I stopped doing scRRBS experiment for a while since I never get it works for single nuclei, and I think I should use the same barcoded methylated adaptors as used by Dr. Tang's group.
  • I found an old TrueSeq DNA Sample Prep kit in (Set A, part # 15013178) -20C. I then wanted to try these barcoded adaptors for ssRRBS while waiting for TrueSeq kit requested by Dr. Zhang. In this kit, I found only 6 indexed adaptors, including Ind2, Ind 4, Ind 5, Ind 6, Ind7 and Ind 12.
  • I have contacted with Dr. Tang's group for more information of scRRBS protocol in very details, and found there are many things I did differently from them. To be able to repeat the protocol and get it works for single cell, I followed everything noted by them.

More information from Dr. Tang's group[edit]

  • They used 80% of bead purified (two-round purification) 1st round amplicons as the template for the 2nd round PCR.
  • In both the 1st round and the 2nd round PCR, they did not do qPCR to monitor amplicons. They said that that the bisulfite-treated DNA was extremely low, so they did not monitor it.
- I think this might be the key reason that I never get success in single-nuclei experiment as I alway stopped reaction during the 2nd round PCR earlier before reaching 22 cycles (between 12-15 based on qPCR curve)
  • They heat-inactivate after MspI digestion, end-repair/dA-tailing, and methylated adaptors ligation
- MspI (not specify)
- End-repair/dA-tailing (I did 75C, 20min
- Ligation (65C, 20min) --> from Gu et al, 2011 (Nature Protocol). They suggest not to heat the lid since it could potentially destroy T4 DNA ligase.
  • They incubate ligation reaction at 16C, 30min --> 4C (at least 8hr). I previously incubate at 16C for at least 12h.
  • For PCR, thy used 200uM of dNTP and 300nM of primer-pair
  • I share all of these info with Yun Liu, the postdoctoral fellow in Dr. Feinberg's group, since he wants to try this protocol too.

NOTE[edit]

  • I used flow-sorted nuclei on 2014-04-10 for this experiment.
  • I still skipped unmethylated lambda DNA since I want to avoid the background in trial experiment. Once the protocol is settle, I will include it to see bisulfite conversion rate
  • I increased primer concentration in both 1st round and 2nd round PCR to 0.3mM or 300uM


Experimental Procedures[edit]

Plate layout[edit]

' 1 2 3
A 1 100 0
B 1 100 0
C 1 20 0
D 1 20 0
E 1 10 0
F 1 10 0
G 1 1 0
H 1 1 0
  • I include many of 0 nuclei since I want to see the consistency in all of them.
  • Some steps were not the same as Dr. Tang'g group suggestion since I got his email after I started experiment.

1) Cell lysis[edit]

Prep
- Thaw nuclei from -80C & spin down at 2,000rpm for 5min (96-well plate rotor, 5min)

- Add 1ul of protease
- Spin down the plate at 2,000rpm for 2min
- Mix by gentle pulse-vortexting for 10x
- Spin down the plate at 2,000rpm for 3min
- I tried to avoid pipetting up and down to mix the reaction to prevent nuclei/DNA lost.
- I notice solution was mixed well and no foaming generated
- I spin down the plate before and after mixing quite long to make sure that all reagents were collected to the bottom of the well
- Incubate at 50C for 3hr
- Heat inactivate at 75C for 30min
- Set program to hold at 15C
- Spin down the plate at 2,000rpm for 1min before continuing to next step


2) DNA fragmentation with MspI[edit]

  • Incubated released naked DNA with 9units of MspI in 18ul reaction at 37C for 3hr.

Prep
- Prepare MspI reaction mix

Components Volume (ul) 26x rxn mix
Lysed nuclei 5.00 0.00
10X Tango buffer 2.00 52.00
MspI 0.90 23.40
H2O 10.10 262.60
Total 18.00 338.00

- Aliquot 42ul of MspI enzyme mix to each tube in 8-tube strip

- Add 13ul to each well with multi-channel pipette
- Spin down the plate at 2,000rpm for 2min
- Mix by gentle pulse-vortexting for 10x
- Spin down the plate at 2,000rpm for 3min
- Incubate at 37C for 3hr
- Set program to hold at 15C
- Spin down the plate at 2,000rpm for 1min before continuing to next step


3) Gap-filling/dA-tailing[edit]

  • Add 5 units of Klenow fragment exo-, supplemented with 1mM dATP, 0.1 mM dGTP and 0.1 mM of dCTP in 20ul reaction. (Skip dTTP because enzyme cleaves C^CGG)

Prep
- Aliquot 5ul of dA:dC:dG mix (20mM:2mM:2mM) to each tube of 8-tube strip
- Aliquot 3.5ul of Klenow fragment exo- to each tube of 8-tube strip

- Add 1ul of dA:dC:dG solution mix to each well with multichannel pipette
- Add 1ul of Klenow fragment exo- to each well with multichannel pipette
- Add 13ul to each well with multi-channel pipette
- Spin down the plate at 2,000rpm for 2min
- Mix by gentle pulse-vortexting for 10x
- Spin down the plate at 2,000rpm for 3min
- I prefer to add reagents with multichannel pipette since I want to make sure no samples were missing during adding reagents and save a lot of my time. Indeed, less pipetting can avoid contamination.
- Incubate at 30C for 20min (for gap-filling) --> 37C for 20min (for extra dA-tailing)
- Heat inactivate enzyme at 75C for 10min
- Set program to hold at 4C
- Spin down the plate at 2,000rpm for 1min before continuing to next step


4) Methylated adaptor ligation[edit]

  • Ligate A-tailed DNA with 1ul of 1:20 diluted Illumina indexed methylated adaptor in total reaction 25ul at 16C for 30min and 4C for at least 8h (I did 14.5h --> next time will fix incubation time at 4C for consistency).

Index list
- I have only 6 indexes, I put Ind_2 and Ind_4 twice in 8-tube strip

Tube_1 Tube_2 Tube_3 Tube_4 Tube_5 Tube_6 Tube_7 Tube_8
Ind_2 Ind_4 Ind_5 Ind_6 Ind_7 Ind_12 Ind_2 Ind_4

Prep
- Mix 1ul of indexed methylated adaptors with 20ul H2O (on ice box)
- Prepare ligation reaction mix

Components Volume (ul) 28x rxn mix
dA-tailed reaction 20.00 0.00
10X Tango buffer 0.50 14.00
HC T4 DNA ligase (30units/ul) 1.00 28.00
10mM ATP 1.25 35.00
H2O 1.25 35.00
Total 24.00 112.00

- Aliquot 14ul of Ligation mix to each tube in 8-tube strip

- Add 1ul of diluted methylated adapter
- Add 4ul of ligation reaction mix
- Spin down the plate at 2000rpm for 2min
- Mix by gentle pulse-vortexting for 10x
- Spin down the plate at 2,000rpm for 3min
- Incubate at 16C for 30min -> 4C for 14.5h (no heat lid)
- Heat inactivate at 65C for 20min
- Spin down the plate at 2,000rpm for 1min before continuing to next step
Well ID Index Sample # Well ID Index Sample # Well ID Index Sample #
A1 Ind_2 #1 A2 Ind_2 #9 A3 Ind_2 #17
B1 Ind_4 #2 B2 Ind_4 #10 B3 Ind_4 #18
C1 Ind_5 #3 C2 Ind_5 #11 C3 Ind_5 #19
D1 Ind_6 #4 D2 Ind_6 #12 D3 Ind_6 #20
E1 Ind_7 #5 E2 Ind_7 #13 E3 Ind_7 #21
F1 Ind_12 #6 F2 Ind_12 #14 F3 Ind_12 #22
G1 Ind_2 #7 G2 Ind_2 #15 G3 Ind_2 #23
H1 Ind_4 #8 H2 Ind_4 #16 H3 Ind_4 #24

2014-04-22

5) Bisulfite conversion[edit]

  • I performed bisulfite conversion using the same procedure following manufacturer's instruction and elute with 31ul elution buffer.

Prep
- Prepare CT Conversion Reagent, by adding 850ul H2O, 50ul of Resuspension Buffer, and 300ul of Dilution Buffer to CT Conversion Reagent (for 25ul DNA sample --> reduce H2O from 900 to 850)

- Add125ul of complete CT Conversion Reagent to adaptor ligated DNA (no sample transfer to the new tube)
- Mix by pipetting 10X
- Spin down the plate at 2,000rpm for 1min
- Incubate following below program
- 98°C for 10 minutes (DNA denaturation)
- 64°C for 2.5 hours (Bisulfite conversion)
- 4°C storage for up to 20 hours or continue to desulfonation

Prep
- Mix 600:1 ratio of Binding Buffer and 10ng/ul tRNA
- For 24 rxn, I mixed 14.7mL of Binding Buffer with 24.5 ul of 10ng/ul tRNA

- Add 601ul of Binding Buffer/tRNA mix to the column
- Bind DNA to column by transfer bisulfite-treated DNA to the column and mixing by pipetting up and down for 5X. I rinse the well with small amount of Binding Buffer to transfer DNA to the column as much as possible
- Spin down 14,000rpm for 30sec. Discard spnt
- Wash with 100ul Wash buffer
- Spin down 14,000rpm for 30sec
- Incubate with 200ul of Desulphonation Buffer for 15min
- Spin down 14,000rpm for 30sec
- Wash column with 200ul Wash Buffer.
- Spin down 14,000rpm for 30sec. Discard spnt
- Wash the column with 200ul Wash Buffer.
- Spin down 14,000rpm for 2min
- Elute converted DNA with warm (~60C) 31ul Elution Buffer. This should have ~30ul DNA left for PCR

6) PCR amplification[edit]

Primer info.
- TruS_F: 5'- AATGATACGGCGACCACCGAGATC -3' (Tm = 67.1 C)
- TruS_R: 5'- CAAGCAGAAGACGGCATACGAGAT -3'(Tm = 65.5 C)
- I designed PCR primers a little longer (~3bp) than the ones used in Boyle P et al, 2012

1st round PCR[edit]

Prep

Components Conc unit Final conc. unit Volume (ul) 26 rxn mix
Bis-cvt DNA 30.00 0.00
10X Reaction buffer 10 X 1 X 5.00 130.00
dNTP mix 10 mM 0.2 mM 1.00 26.00
TruS_F 10 uM 0.3 uM 1.50 39.00
TruS_R 10 uM 0.3 uM 1.50 39.00
PfuTurbo Cx 2.5 Unit/ul 1 unit 0.40 10.40
50X SYBG 50 X 0.8 X 0.80 20.80
H2O 9.80 254.80
- Aliquot 20ul, add 30ul of bisulfite-treat adaptor-ligated DNA
95C for 2min --> [95C for 20sec -> 60C for 30sec -> 72C for 1min] X 25 cycles --> 72C for 2min
- Purified the 1st round amplicons with AMPurebeads 2X (1:1 ratio)

AMPure bead purification[edit]

Prep
- Freshly prepare 20mL of 75% EtOH by mixing 15mL of 100% EtOH with 5mL of H2O
- Add ~2.5mL of resuspened AMPure bead in 30mL reservoir

- Add 50ul AMPure bead. Mix by pipetting 10x
- Sit for 8min
- Transfer to sit on magnet for 5min
- Wash twice with 160ul freshly prepared 80% EtOH
- Dry the bead for 3-5min
- Resuspend with 50 H2O
- Add 50ul of fresh AMPure bead. Mix by pipetting 10x
- Sit for 5min
- Transfer to sit on magnet for 5min
- Wash twice with 160ul freshly prepared 80% EtOH
- Dry the bead for 3-5min (make sure that the beads are completely dried out to avoid EtOH inhibiting PCR)
- Resuspend the bead with 40ul H2O
- Transfer purified 1st round amplicons to 8-tube strip with cap
- Sit the strip tube on magnet before adding to the 2nd round PCR to avoid bead contamination in PCR
- 32ul of bead purified 1st round amplicons will be added to the 2nd round PCR (32/40 -> 80%)
- I saved the rest of bead purified 1st round amplicons

2nd round PCR[edit]

Components Conc unit Final conc. unit Volume (ul) 26 rxn mix
Purified 1st round DNA 32.00 0.00
5X Phusion HF buffer 5 X 1 X 10.00 260.00
dNTP mix 10 mM 0.2 mM 1.00 26.00
TruS_F 10 uM 0.3 uM 1.50 39.00
TruS_R 10 uM 0.3 uM 1.50 39.00
50X SYBR 50 X 0.8 X 0.80 20.80
Phusion HF 2 unit/ul 1 unit 0.50 13.00
H2O 2.70 70.20
- Aliquot 18ul, add 32ul of bead purified 1st round amplicons
98C for 2min --> [98C for 10sec -> 60C for 30sec -> 72C for 1min] X 22 cycles --> 72C for 2min
- I did qPCR but let the reaction ran to 22 cycles for all samples.

Results[edit]

- Purified 40ul of 2nd round PCR with 1:1 ratio
- Eluted with 40ul EB buffer
- Loaded 4ul of bead purified PCR products and also load 4ul some of unpurified PCR products

Ligation condition:

- 1ul of 1:20 diluted Illumina barcoded adaptors
- 16C for 30min -> 4C for 14.5h

File:Abc.png File:Fgh e.png

File:Cde.png
- Since I can not put all samples in the same gel, I stained the gels for 4min then replaced staining solution with 0.5X TBE buffer. I also used the same set up for all images

Discussions[edit]