Sam:LabNotes/Microbione/2009-2-3
Jump to navigation
Jump to search
Primer design for human 18S and Bacteria 16S
Objective
Besides the realtime monitoring,
- Design 18S primers for positive control / validation purpose of a successful MDA reaction using human genome template.
- Design 16S primers for positive control / validation purpose of a successful MDA reaction using bacteria genome template.
- These primers could also be used to detect the contamination of exogenus gDNA.
Human S18 primer
- Collect the human S18 cDNA sequence
- Clean the sequcne and mask the inconsistat nucleotide
- Paste the sequence on KZ's Primer3 calculatorlink title
- Criteria:
Primer size: Min: 18bp, opt:20 bp, Max: 22bp Product size: ~200 bp; ~300 bp Annealing Temp: Min:57, Opt:58, Max:59
- Pick up two primers with differnt size of amplicon.
>h18S_211_f TTGCTGCAGTTAAAAAGCTC >h18S_211_r CATTATTCCTAGCTGCGGTA
OLIGO start len tm gc% any 3' seq LEFT PRIMER 758 20 57.86 40.00 6.00 2.00 TTGCTGCAGTTAAAAAGCTC RIGHT PRIMER 968 20 57.56 45.00 4.00 2.00 CATTATTCCTAGCTGCGGTA SEQUENCE SIZE: 1969 INCLUDED REGION SIZE: 1969 PRODUCT SIZE: 211, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 1.00