Sam:LabNotes/Microbione/2009-2-3

From ZhangLabWiki
Revision as of 06:42, 9 February 2009 by >Sam Chiang (→‎Human S18 primer)
Jump to navigation Jump to search

Primer design for human 18S and Bacteria 16S

Objective

Besides the realtime monitoring,

  1. Design 18S primers for positive control / validation purpose of a successful MDA reaction using human genome template.
  2. Design 16S primers for positive control / validation purpose of a successful MDA reaction using bacteria genome template.
  3. These primers could also be used to detect the contamination of exogenus gDNA.


Human S18 primer

  1. Collect the human S18 cDNA sequence
  2. Clean the sequcne and mask the inconsistat nucleotide
  3. Paste the sequence on KZ's Primer3 calculator[1]
  4. Criteria:
    Primer size: Min: 18bp, opt:20 bp, Max: 22bp
    Product size: ~200 bp; ~300 bp
    Annealing Temp: Min:57, Opt:58, Max:59

Results

  1. Using Netprimer[2]to evaluate primer structure.
  2. Pick up two primers with differnt size of amplicon.
    >h18S_211_f
    TTGCTGCAGTTAAAAAGCTC
    >h18S_211_r
    CATTATTCCTAGCTGCGGTA
    -----------------------------------------------
    >h18S_306_f
    GTACAGTGAAACTGCGAATG
    >h18S_306_r
    CGACTACCATCGAAAGTTGA
    -----------------------------------------------
  • Human S18 design records in word document[[Media:Human 18S rRNA gene primer desing.doc]