Matt:LabNotes/2017-4-22
Jump to navigation
Jump to search
In tube SplintR Test with formamide and ET SSB
Test Conditions
- Standard: SplintR only
- SplintR incubated for 30min instead of 15min
- SplintR + 10% formamide
- SplintR + 20% formamide
- SplintR + 30% formamide
- SplintR + 250ng ET SSB
- SplintR + 250ng ET SSB added first
- Positive Control: Ampligase
- For each test conditions have
- one sample with ALL padlock probes and template
- Should see amplification
- one sample with all padlock probes and template MINUS ppMALAT1
- Should not see amplification
- one sample with ALL padlock probes and template
Padlock Probes and Template
- Same as Matt:LabNotes/2017-4-7 with the addition of ppMALAT1 for consistency
- ppCUX2
- ppBCL11B
- ppRELN_1
- ppGFAP
- ppMALAT1
- /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
- Template for ppMALAT1: MALAT1_template
- /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT
Protocol
Sample # | Condition | 100nM template + PP mix | 55C 17hr | 55C | 37C | Exo I/III |
1 | SplintR 15min | 1.5 or 1.8ul (0.3ul of each 10nM oligo) | 3ul SplintR Buffer + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |
2 | SplintR 30min | 1.5 or 1.8ul (0.3ul of each 10nM oligo) | 3ul SplintR Buffer + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |
3 | SplintR + 10% formamide | 1.5 or 1.8ul (0.3ul of each 10nM oligo) | 3ul SplintR Buffer + 3ul formamide + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |
4 | SplintR + 20% formamide | 1.5 or 1.8ul (0.3ul of each 10nM oligo) | 3ul SplintR Buffer + 6ul formamide + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |
5 | SplintR + 30% formamide | 1.5 or 1.8ul (0.3ul of each 10nM oligo) | 3ul SplintR Buffer + 9ul formamide + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |
6 | SplintR + ET SSB | 1.5 or 1.8ul (0.3ul of each 10nM oligo) | 3ul SplintR Buffer + H2O to 30ul | - | Add 3ul SplintR Mix + 0.4ul ET SSB | 1ul Exo I + 1ul Exo II |
7 | SplintR + 2step ET SSB | 1.5 or 1.8ul (0.3ul of each 10nM oligo) | 3ul SplintR Buffer + H2O to 30ul | Add 0.4ul ET SSB | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II |
8 | Ampligase | 1.5 or 1.8ul (0.3ul of each 10nM oligo) | 3ul Ampligase Buffer + H2O to 30ul | Add 3ul Ampligase Mix | - | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |
- Combine padlock probes and template in 1X Ligase buffer and possibly formamide
- Add mineral oil on top
- Incubate at 55C for 17hr
- To sample 7 (2-step ET SSB) add 200ng (0.4ul) of ET SSB and keep at 55C for 30min
- To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min
- Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O
- After sample 7 has ET SSB for 30min move samples 1-7 to 37C
- Add 3ul SplintR Mix and incubate 15min
- SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O
- 30min incubation for sample 2
- Also add 0.4ul ET SSB to sample 6
- Put all samples on ice and add 2ul Exo I/III mix
- Also add 0.4ul ET SSB to samples 1-5 and 8
- Incubate at 37C for 1hr
- qPCR all 16 samples
Components | 1X Volume | 16X Volume |
Captured template | 5 | 0 |
10uM ISB_CA_AF | 0.4 | 6.4 |
10uM ISB_CA_AR.T1 | 0.4 | 6.4 |
2X KAPA SYBG MM | 12.5 | 200 |
H2O | 6.7 | 107.2 |
Total | 25 | 320 |
- Aliquot 20ul from 16X master mix and add 5ul captured template
Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min
Mistakes
- Forgot to heat inactivate (incubate at 94C 10min) after ligation and before Exo I/III
- Accidentally added 3ul 10X SplintR Buffer to samples 1-3 that HAVE ppMALAT1
- Still added 3ul SplintR Mix afterwards
- Do zymo columns after Exo I/III next time
Results
raw data here
File:20170423 qPCR ppCapture SplintRformamideETSSB.PNG
- Possible options: 10% and 20% formamide
- ET SSB added in 2 steps does seem to increase the number of captured padlock probes
- Next time do a ET SSB + 10% formamide sample
- Next time try less template concentration... see if it can distinguish the smaller amount