Matt:LabNotes/2017-5-15

From ZhangLabWiki
Revision as of 22:48, 16 May 2017 by >Mzcai (Created page with "=Third Try: in tube SplintR Test with formamide and ET SSB= *[[Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of ...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Third Try: in tube SplintR Test with formamide and ET SSB

Test Conditions

  1. Standard: SplintR only
  2. SplintR + 5% formamide
  3. SplintR + 7.5% formamide
  4. SplintR + 10% formamide
  5. SplintR + 12.5% formamide
  6. SplintR + 15% formamide
  7. SplintR + 17.5% formamide
  8. Positive Control: Ampligase
  • For each test conditions have
    • one sample with ALL padlock probes and template
      • Should see amplification
    • one sample with all padlock probes with NO MALAT1 template
      • Should not see amplification

Padlock Probes and Template

  • ppCUX2
  • ppBCL11B
  • ppRELN_1
  • ppGFAP
  • ppMALAT1
    • /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
  • Template for ppMALAT1: MALAT1_template
    • /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT

Protocol

Sample # Condition 30nM PP + Template 10X Buffer Formamide H2O Total
1 SplintR 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 22.5 or 21.6 30
2 SplintR + 5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 1.5 21 or 20.1 30
3 SplintR + 7.5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 2.25 20.25 or 19.35 30
4 SplintR + 10% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 3 19.5 or 18.6 30
5 SplintR + 12.5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 3.75 18.75 or 17.85 30
6 SplintR + 15% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 4.5 18 or 17.1 30
7 SplintR + 17.5 formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 5.25 17.25 or 16.35 30
8 Ampligase 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 22.5 or 25.2 30
  1. Combine padlock probes and template in 1X Ligase buffer and possibly formamide
  2. Add mineral oil on top
  3. Incubate at 55C for 18hr