Matt:LabNotes/2017-6-7
Jump to navigation
Jump to search
Sixth Try: in tube SplintR Test with formamide
- First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditions tried
- Second try had unexpected trend with increasing formamide led to increased sensitivity
- Third try confirmed second try
- Fourth try had unexpected non-continous trend
- Fifth try
- Repeat Fifth Try with 95C 3min denature before hybridization
Test Conditions
- Standard: SplintR only
- SplintR + 5% formamide
- SplintR + 10% formamide
- SplintR + 15% formamide
- SplintR + 1M Betaine
- SplintR + 10% dimethylformamide
- SplintR + 5% DMSO
- Positive Control: Ampligase
- For each test conditions have
- one sample with ALL padlock probes and template
- Should see amplification
- one sample with all padlock probes with NO MALAT1 template
- Should not see amplification
- one sample with ALL padlock probes and template
Padlock Probes and Template
- ppCUX2
- ppBCL11B
- ppRELN_1
- ppGFAP
- ppMALAT1
- /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
- Template for ppMALAT1: MALAT1_template
- /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT
Protocol
Sample # | Condition | 30nM PP + Template | 10X Buffer | Formamide | DMF | Betaine | DMSO | H2O | Total |
1 | SplintR | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 0 | 0 | 0 | 22.5 or 21.6 | 30 |
2 | SplintR + 5% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 1.5 | 0 | 0 | 0 | 21 or 20.1 | 30 |
3 | SplintR + 10% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 3 | 0 | 0 | 0 | 19.5 or 18.6 | 30 |
4 | SplintR + 15% formamide | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 4.5 | 0 | 0 | 0 | 18 or 17.1 | 30 |
5 | SplintR + 10% DMF | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 3 | 0 | 0 | 19.5 or 18.6 | 30 |
6 | SplintR + 1M Betaine | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 0 | 6 | 0 | 16.5 or 15.6 | 30 |
7 | SplintR + 5% DMSO | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 0 | 0 | 1.5 | 21 or 20.1 | 30 |
8 | Ampligase | 4.5 or 5.4 (0.9ul of each 1uM oligo) | 3 | 0 | 0 | 0 | 0 | 22.5 or 21.6 | 30 |
- Combine padlock probes and template in 1X Ligase buffer and possibly additives
- Add mineral oil on top
- Incubate at 95C for 3min
- Incubate at 55C for 18hr