Matt:LabNotes/2017-6-7

From ZhangLabWiki
Revision as of 03:25, 9 June 2017 by >Mzcai (Created page with "=Sixth Try: in tube SplintR Test with formamide= *Matt:LabNotes/2017-4-22|First try showed SplintR with 10% formamide had the best sensitivity and specificity of the conditi...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Sixth Try: in tube SplintR Test with formamide

  • Repeat Fifth Try with 95C 3min denature before hybridization

Test Conditions

  1. Standard: SplintR only
  2. SplintR + 5% formamide
  3. SplintR + 10% formamide
  4. SplintR + 15% formamide
  5. SplintR + 1M Betaine
  6. SplintR + 10% dimethylformamide
  7. SplintR + 5% DMSO
  8. Positive Control: Ampligase
  • For each test conditions have
    • one sample with ALL padlock probes and template
      • Should see amplification
    • one sample with all padlock probes with NO MALAT1 template
      • Should not see amplification

Padlock Probes and Template

  • ppCUX2
  • ppBCL11B
  • ppRELN_1
  • ppGFAP
  • ppMALAT1
    • /5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT
  • Template for ppMALAT1: MALAT1_template
    • /5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT

Protocol

Sample # Condition 30nM PP + Template 10X Buffer Formamide DMF Betaine DMSO H2O Total
1 SplintR 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 0 0 0 22.5 or 21.6 30
2 SplintR + 5% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 1.5 0 0 0 21 or 20.1 30
3 SplintR + 10% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 3 0 0 0 19.5 or 18.6 30
4 SplintR + 15% formamide 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 4.5 0 0 0 18 or 17.1 30
5 SplintR + 10% DMF 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 3 0 0 19.5 or 18.6 30
6 SplintR + 1M Betaine 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 0 6 0 16.5 or 15.6 30
7 SplintR + 5% DMSO 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 0 0 1.5 21 or 20.1 30
8 Ampligase 4.5 or 5.4 (0.9ul of each 1uM oligo) 3 0 0 0 0 22.5 or 21.6 30
  1. Combine padlock probes and template in 1X Ligase buffer and possibly additives
  2. Add mineral oil on top
  3. Incubate at 95C for 3min
  4. Incubate at 55C for 18hr