AlanFung:LabNotes/EZ/2009-3-25

From ZhangLabWiki
Jump to navigation Jump to search

EZ DNA Methylation Direct - 10 GM20431 cells[edit]

Objective[edit]

  • Confirmation of the bisulfite conversion of GM20431 for 10 cells
  • Elute DNA with 8uL elution buffer
  • Use all 8uL dna as template for one pair of primer
  • Reduce washing step from two times to one
  • For one set (3x10cells- one washing before elution)
  • For the other set (2x10cells-two washing before elution

Samples & Materials[edit]

  • GM20431 P20 cells
  • EZ DNA Methylation Direct Kit 03/11/09
  • Primers - From IDT
  --------------------------------------------------
  0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG
  0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA
  0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT
  0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA
  0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT
  0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA
  --------------------------------------------------
  • Creating 100uM primer
0.1_F_chr22         27.9nmol 
RNAse free H2O      279uL
0.1_R_chr22         31.8nmol
RNAse free H2O      318uL
0.8_F_chr21         31.30nmol
RNAse free H2O      313uL
0.8_R_chr21         31.70nmol
RNAse free H2O      317uL
0.9_F_chr8          30.10nmol
RNAse free H2O      301uL
0.9_R_chr8          29.30nmol
RNAse free H2O      293uL

  • Making 3.3uM primer working solution

Dilute 33uL 100uM primer with 967uL RNAse free H2O


  • Jurkat gDNA (100ug/mL)
  • Dilute 1uL stock gDNA with 99uL RNAse-free H20
  • 2% Agarose Gel

Overview[edit]

  • Cell Preparation
  • Bisulfite Conversion
  • Elution
  • PCR amplification
  • Agarose Gel Electrophoresis

Procedures[edit]

  • Turn on the incubator heat it up to 50C


  • Cell Preparation


Resuspended cells in T25 flask by repeat pipetting Perform cell counting

  • Cell Count of GM20431 P20: 207,656 cells/mL


To get 1,000,000 cells: 1,000,000/(207,656cells/mL)=4.816mL aspirate 4mL + 816uL cell suspension and transfer to a 50mL centrifuge tube Spin down at 10,000 rpm for 5 mins Aspirate supernatant completely Resuspended cells with 1000uL UV treated PBS (1000cells/uL)

  • Cell Dilution

Performed cell dilution to reach concentration of 11.11 cells/uL and 1.11 cells/uL

  • 111.11 cells/uL

Dilute 10uL (1000cells/uL)cell suspension with 80uL UV TREATED PBS IN PCR TUBE

  • 11.11 cells/uL

Dilute 10uL (111.11 cells/uL) cell suspension with 90 uL UV TREATED PBS IN PCR TUBE

  • 1.11 cells/uL

Dilute 10uL (11.11 cells/uL) cell suspension with 90 uL UV TREATED PBS IN PCR TUBE


  • Sample Digestion with Proteinase K
                                         1rxn x 6
     --------------------------------------------
     RNAse-free H2O              0.0        0.0
     Protinase K                 1.0        1.0
     M-Digestion Buffer (2X)     10.0       10.0
     1.11 cells/uL                         9.0
     --------------------------------------------
                                 20uL       20uL

Vortex and spindown

Incubate the samples at 50C for 20 mins

  • Bisulfite Conversion of DNA

Add in 130uL of CT conversion Reagent Solution directly to the digested samples

Vortex and spin down

Perform reaction in thermocycler

      Step1   98C, 8m
      Step2   64C, 3.5hr
      Step4   4C,  storage for up to 20 hr

Add 600uL of M-Bindin Buffer into a IC Column

Load 150uL of samples into IC column

CLOSE CAP AND MIX BY INVERTING THE COLUMN SEVERAL TIMES

Centrifuge at 20,000g for 30s Discard flow through

Add 100uL M-Wash Buffer to column Repeat Centrifuge

Add 200uL of M-Desulphonation Buffer to column let stand at RT for 20m Repeat centrifuge step

Add 200uL of M-Wash Buffer to the column Repeat Centrifuge [REPEAT WASHING STIP FOR ONE SET ONLY]

Place column in a 1.5mL tube Add in 8uL of M-Elution Buffer directly to the column matix Repeat Centrifuge


  • PCR


 Sample A 10 cell GM20431 (Single Washing)
                     A         B         C
 -------------------------------------------------
                     CHR22     CHR21     CHR8
 2X iQ Super Mix     20        20        20
 Primer F (3.3uM)    6         6         6  
 Primer R (3.3uM)    6         6         6     
 gDNA                8         8         8 
 -------------------------------------------------
 Total                                   40uL


 Sample B 10 cell GM20431 (Double Washing)
                     A         B         C
 -------------------------------------------------
                     CHR22     CHR21     CHR8
 2X iQ Super Mix     20        20        20
 Primer F (3.3uM)    6         6         6  
 Primer R (3.3uM)    6         6         6     
 gDNA                8         8         8   
 -------------------------------------------------
 Total                                   40uL


A-CHR22 F/R
B-CHR21 F/R
C-CHR8  F/R


Perform PCR reaction in thermocycler

      Step1   96C, 3m
      Step2   95C, 30s
      Step3   62C, 1m
      Step4   72C, 1m
      Step5   Go to step2 repeat 39 times
      Step6   72C, 5m
      Step7   4C,  Forever
  • Gel Electrophoresis
                                 Gel 1
Well             1     2     3     4     5    6     7      8
-----------------------------------------------------------------
Content          Blank AA    AB    AC    BA   BB    BC     Ladder
Sample           0     10    10    10    10   10    10     3
6X Loading Dye   0     2     2     2     2    2     2      3
-----------------------------------------------------------------
Total                                               14uL   9uL



  • Run gel at 135 V for 20 min.

Results[edit]

File:ZhangLab 2 2009-03-26 11hr 16min crop.jpg

  • All 3 pairs of primers showed up for 1 washing before elution
  • Only CHR21 primer showed up for double washing before elution

Suggestion[edit]

  • Repeat experiment with single cell
  • Only perform one washing