Alice:Single cell tracing and RNA-seq Lab Notes/Belmonte lab collaboration projects
Jump to navigation
Jump to search
In vivo genome editing via CRISPR-Cas9 mediated homology-independent targeted integration[edit]
project overview[edit]
- CRISPR mediated tissue specific knock-in of GFP into the Rosa-26 locus transgenic mice, the locus is driven by CAG promoter
- Kei from Belmonte lab has already established the system and injected into transgenic mice muscle cells, also heart and liver
- we will perform analysis on DNA-seq validation/quantification of knock-in efficiency and off-target rate/sites
data for revision of the manuscript[edit]
- The sequencing are done in SE 150+8+8 bp setting
- The sample were pooled together as following, and sequenced on 5/2/2016 Miseq:
2nd round of primer 1 (i7) | 2nd round of primer 2 (i5) | conc. (ng/ul) | vol | amount | total vol | total amount | final concentration | |
---|---|---|---|---|---|---|---|---|
1 On target/Liver Cas- | N701 | S501 | 11.2 | 4.5 | 50 | 67.5 | 800 | 11.85 |
2 On target/Liver Cas+ | N701 | S502 | 13.9 | 3.6 | 50 | |||
3 On target/Heart Cas- | N701 | S503 | 11.2 | 4.5 | 50 | |||
4 On target/Heart Cas+ | N701 | S504 | 8.2 | 6.1 | 50 | |||
5 LAMPCR-GFP3'/Liver Cas- | N701 | S505 | 11.5 | 4.3 | 50 | |||
6 LAMPCR-GFP3'/Liver Cas+ | N701 | S506 | 12.7 | 3.9 | 50 | |||
7 LAMPCR-GFP3'/Heart Cas- | N701 | S507 | 9.5 | 5.3 | 50 | |||
8 LAMPCR-GFP3'/Heart Cas+ | N701 | S508 | 7.4 | 6.8 | 50 | |||
9 LAMPCR-AAVITR5'/Liver Cas- | N702 | S501 | 12 | 4.2 | 50 | |||
10 LAMPCR-AAVITR5'/Liver Cas+ | N702 | S502 | 16 | 3.1 | 50 | |||
11 LAMPCR-AAVITR5'/Heart Cas- | N702 | S503 | 12.8 | 3.9 | 50 | |||
12 LAMPCR-AAVITR5'/Heart Cas+ | N702 | S504 | 13.7 | 3.6 | 50 | |||
13 LAMPCR-AAVITR3'/Liver Cas- | N702 | S505 | 13.1 | 3.8 | 50 | |||
14 LAMPCR-AAVITR3'/Liver Cas+ | N702 | S506 | 15 | 3.3 | 50 | |||
15 LAMPCR-AAVITR3'/Heart Cas- | N702 | S507 | 16.3 | 3.1 | 50 | |||
16 LAMPCR-AAVITR3'/Heart Cas+ | N702 | S508 | 14.2 | 3.5 | 50 |
Analysis[edit]
- adopt an different published approach to analyze the OTS and on-target data from first batch of cells, so these are the papers that I looked at:
- Genome editing assessment using CRISPR Genome Analyzer (CRISPR-GA). Bioinformatics. 2014 Oct 15;30(20):2968-70. doi: 10.1093/bioinformatics/btu427. Epub 2014 Jul 1. (http://54.80.152.219/index.php)
- DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. 2013 Sep;31(9):827-32. doi: 10.1038/nbt.2647. Epub 2013 Jul 21.
Workflow of the analysis (both from above paper and ourselves') 1. only uses aligners of choice (e.g. BLAT or Smith-Waterman alignments) to perform sequence alignment against custom Ai14 transgenic mice genome chr6 tdTomato knock-in: 113076031-113077114 (left arm); 113077114- 113076032(right arm) 2. then count the # of reads that fulfill certain criteria (e.g. matched base pairs comprised more than 85% of their total length) 3. calculate the indel rate by having # of reads with indel/total reads(# of reads with indel+# of reads with ~95% of match) 4. perform MLE analysis between negative control and positive sample to calculate the estimated indel rate Alignment (perl script): my @file=glob("*CAGOn*.fastq") /home/k4zhang/softwares/bwa-0.7.5a/bwa mem -O 4 -R \'\@RG\tID:$file\tSM:OTS\tPL:illumina\tLB:$file\' /home/zhl002/genomeDB/Ai14/mm9_Ai14.fa $file > $file.sam samtools view -Sb -o $file.bam $file.sam samtools sort -o $file.sorted.bam $file.bam samtools index $file.sorted.bam
Read filtering (perl script): use strict; my $config=shift @ARGV; my $minM=127; open F,"$config"; while(<F>){ chomp; my($cor,$file)=split /\s+/; next if /^\s+$/; chdir "/oasis/tscc/scratch/zhl002/kei_012616/data"; my @bam=glob("*$file*Ai14_sorted*bam"); foreach my $bam(@bam){ system("samtools view $bam $cor> $bam.pad"); open F2,"$bam.pad" || die "cannot open $bam.pad\n"; my $indelReads; my $totalReads; my $indelNum; my $SHclipReads; my $qname; my $MreadsNum; my $NskipReads; my $quitematch; while(<F2>){ $totalReads++; my @tmp=split /\s+/; my @M=($tmp[5]=~/(\d+)M/g); my $Mnum=&msum($tmp[5]); my $maxMnum=&max(@M); if($maxMnum>=$minM){ $MreadsNum++; $indelReads++ if $tmp[5]=~/(\d+I)|(\d+D)/; $indelNum +=(&INSsum($tmp[5])+&DELsum($tmp[5])); $NskipReads++ if $tmp[5]=~/(\d+N)/; $quitematch ++ if $Mnum>=140; $SHclipReads++ if $tmp[5]=~/(\d+S)|(\d+H)/; } } my $ratio1=sprintf("%.4f",$indelReads/($quitematch+$indelReads+1)); my $ratio2=sprintf("%.4f",$indelNum/($quitematch+$indelReads+1)); my ($id,undef)=split /-/,$bam; print "$bam\t$file\t$id\t$cor\t$indelReads\t$indelNum\t$quitematch\t$ratio1\t$ratio2\t$SHclipReads\t$totalReads\n"; close OUT; close OUT2; system("rm $bam.pad"); } } sub msum($){ my $string=shift @_; my @num=($string=~/(\d+)M/g); my $sum; foreach my $num(@num){ $sum +=$num; } return($sum); } sub INSsum($){ my $string=shift @_; my @num=($string=~/(\d+)I/g); my $sum; foreach my $num(@num){ $sum +=$num; } return($sum); } sub DELsum($){ my $string=shift @_; my @num=($string=~/(\d+)D/g); my $sum; foreach my $num(@num){ $sum +=$num; } return($sum); } sub max(@){ my @xx=@_; my $max=0; foreach my $x(@xx){ $max=$x if $x>$max; } return($max); }
MLE algorithm (R script): #n is the number of reads with in/del n=36884 #R is the total number of reads (reads with indel + reads with perfect match of full sequence length, here is 150bp) R=564402 #p is the indel ratio (reads with indel/total reads) in positive sample (cas+) p=0.0755 #q is the indel ratio (reads with indel/total reads) in negative/control sample (cas-, but donor plasmid is present) q=0.0596 qqq<-c() #OPTIONAL: use input file that has list of samples with the above values printed in each column, then we can perform MLE on multiple samples at once proxy<-read.table("proxy.txt",head=F,sep="\t",row.names=1,as.is=T) qqq<-c() for (i in 1:nrow(proxy)){ n=proxy[i,1] R=proxy[i,2]+n p0=proxy[i,3] q0=proxy[i,4] pp<-c() qq<-c() for(p0 in seq(p0,0,-0.00001)){ q<-dbinom(round(n-R*p0),round(R*(1-p0)), q0) q1=c(q,p0) qq<-rbind(qq,q1) } qx<-qq[which.max(qq[,1]),] qqq<-rbind(qqq,qx) } rownames(qqq)=rownames(proxy) qqq write.table(qqq[,2]*100,file="name.txt",row.names=T,col.names=NA,sep="\t",quote=F)
LAMPCR on-target ratio analysis: perl script for read filtering: #!/usr/bin/perl use Cwd; chdir getcwd; my $bam=shift @ARGV; system("samtools view $bam $cor> $bam.pad"); open F2,"$bam.pad"; open OUT, ">$bam.stat"; my %qreads; while(<F2>){ my @tmp=split /\s+/; next if $tmp[5]=~/\*|uncut/i; if($tmp[5]=~/(\d+)S\w+(\d+)S|(\d+)S\w+(\d+)H|(\d+)H\w+(\d+)S|(\d+)H\w+(\d+)H/){ my $num=$1+$2+$3+$4+$5+$6+$7+$8; } my $solid=151-$num; $qreads{$solid}++; } foreach my $num(sort keys %qreads){ print "$num\t$qreads{$num}\n"; }
knock-in ratio calculation R script: j=0.15 k=0.5 rlt<-c() file=list.files(pattern="*sam.tam.stat.output") for (i in 1:length(file)){ data=read.table(file[i],sep="\t") sub1<-subset(data,data[,1]<151*j) sub2<-subset(data,data[,1]<151*k) n=sum(sub1[,2]) R=(sum(sub2[,2])) ratio<-sum(sub1[,2])/(sum(sub2[,2])) tmp<-c(n,R,ratio) rlt<-rbind(rlt,tmp) } rownames(rlt)=file write.table(rlt,file="ratio.rlt.txt",row.names=T,col.names=NA,sep="\t",quote=F)
Results[edit]
# | chromosome | position | sequence | PAM | % indel (MLE) |
---|---|---|---|---|---|
On_Target | chr6 | GAGGAACTTCTTAGGGCCCGCGG | CGG | 18.917 | |
On_Target_Liver | Chr6 | GAGGAACTTCTTAGGGCCCGCGG | CGG | 11.477 | |
On_Target_Heart | Chr6 | GAGGAACTTCTTAGGGCCCGCGG | CGG | 3.301 | |
OTS1 | chr13 | 9534141 | CAGGAACTTCTTAGGTCCCGTGG | TGG | 0.0001 |
OTS2 | chr14 | 85157555 | CGGAAACATCTTAGGGCCCGGGG | GGG | 0.0001 |
OTS3 | chr2 | 74925639 | GGAGTACTTCTTAGGGCCCACAG | CAG | 0.14 |
OTS4 | chr15 | 69159526 | CAGGAACATATTAGGGCCCAGGG | GGG | 0.0001 |
OTS5 | chr12 | 100704049 | CAGGAACATGTTAGGGTCCGAGG | AGG | 0.215 |
OTS6 | chrX | 91969928 | CAGGAACGTGTTCGGGCCCGCGG | CGG | 0.0001 |
OTS7 | chrX | 92043584 | CAGGAACGTGTTCGGGCCCGCGG | CGG | 0.0001 |
OTS8 | chr10 | 17440682 | CAGGAACTTCTTAGTGCCCTAAG | AAG | 0.004 |
OTS9 | chr18 | 25702486 | GTGGACCTTTTCAGGGCCCGTGG | TGG | 0.784 |
OTS10 | chr18 | 9212447 | GAGGCCCCTCTTCGGGCCCGGAG | GAG | 0.388 |
OTS11 | chr14 | 46862821 | GTGGAGCATCTTAGGGCCAGTGG | TGG | 0.0001 |
OTS12 | chr12 | 31652981 | GAGCAACAACTTAGGGCCTGCAG | CAG | 0.197 |
Sample ID | % On-target (MLE) |
---|---|
LAMPCR_AAVITR3_Liver | 7.6411176 |
LAMPCR_AAVITR3_Heart | 3.072334 |
LAMPCR_GFP3_Liver | 6.0686491 |
LAMPCR_GFP3_Heart | 1.1098576 |
data for initial submission of the manuscript[edit]
- Kei finished locus specific PCR using the following 12 pairs of primers listed below:
CAGon-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCTAGAGCCTCTGCTAACCATGTTCA CAGon-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGATCTGCAAGCTTTCATTTATTCATCGC 61℃->68℃ 245bp (+KI 1720bp)
CAG-OTS1-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGGGTAGATAACATCTTATTACAATGAGT CAG-OTS1-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTACAATAATTTAGTGCCACCAGATGGAA 60℃->68℃ 171bp F
CAG-OTS2-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAGGAGATTGAGGAACCCCAT CAG-OTS2-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCCACCATCCTCCCCAACCAG 60℃->68℃ 265bp F
CAG-OTS3-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTTCACTGCCCATAGTTTTTATTAAACG CAG-OTS3-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTTAACAGGAGGAAATGTTGCCCTT 60℃->68℃ 197bp F
CAG-OTS4-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAACCAGACAAATGGGCATATAGGAA CAG-OTS4-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGGCCTGCTCAGTATTTTATATCCAGA 60℃->68℃ 207bp F
CAG-OTS5-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTAGGGCAGCTGAGAATAATGTAAAAGTTCG CAG-OTS5-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGCAAACCTTAAAAAGCATCAGA 60 (56)℃->68℃ 142bp F (reverse design)
OTS6 and OTS7 have the same sequence region: CAG-OTS6/7-F2 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGCGGTCCCAGCATATTTAAATCACGG CAG-OTS6/7-R2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGGGGGCCTGACAAGCCAGA 63℃->68℃ 297bp F (reverse design)
CAG-OTS8-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACTAGTTTACTATGCCCGCTGA CAG-OTS8-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCCACTTGCCCATCATCCAC 60℃->68℃ 279bp F
CAG-OTS9-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTCTTCTCAACAAGCTCGCCCCTTT CAG-OTS9-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTTCGCTTCAGCTTCGCATACCCT 60℃->68℃ 141bp F (reverse design)
CAG-OTS10-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGCGGCAGATACAAGAGGACCGAC CAG-OTS10-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTCATCCTCCCGAGTTCGTGTAGGAC 60 (63)℃->68℃ 285bp F
CAG-OTS11-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCAGGCTATAAATCCAAATTCCC CAG-OTS11-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCTTTGGAATTATACATTTCCCGTCT 60℃->68℃ 202bp F
CAG-OTS12-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAAGGCCAGATCACCAGAGAATACCAG CAG-OTS12-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACCAAGGGGAATGAATGTCT 60℃->68℃ 284bp F
- 1st round of PCR (amplification of the target genome locus with overhang tag
Total PCR reaction: 50 ul Template genomic DNA in each reaction: 55.2 ng PCR cycle: 35 cycle ↓ Purification by AMpure XP and resuspend in 40ul water ↓ 2nd round of PCR (Amplification of the 1st round PCR product with Nextera Index primer 1 (N7xx) and primer 2 (S5xx)) Total PCR reaction: 50 ul Template DNA in each reaction: 2ul of the purified PCR product from 1st round PCR PCR cycle: 10 cycle ↓ Purification by AMpure XP and resuspend in 40ul water
- The samples submitted for Miseq on 1/26/2016
ZL-kei-OTSPCR-012416 (pooled all 24 libraries from below); SE 150+8+8; ~300 size range; Read 1 primer: HP10; Index primer: HP12
sample | Primer1 (P7) | primer2 (S5) | conc. (ng/ul) | total (ng) | vol (ul) |
---|---|---|---|---|---|
1 CAGOn/Cas- | N701 | S501 | 16.9 | 59 | 3.5 |
2 CAGOn/Cas+ | N701 | S502 | 5.9 | 59 | 10 |
3 CAG-OTS1/Cas- | N701 | S503 | 11.7 | 59 | 5 |
4 CAG-OTS1/Cas+ | N701 | S504 | 14.5 | 59 | 4.1 |
5 CAG-OTS2/Cas- | N701 | S505 | 11.2 | 59 | 5.3 |
6 CAG-OTS2/Cas+ | N701 | S506 | 15.9 | 59 | 3.7 |
7 CAG-OTS3/Cas- | N701 | S507 | 20.6 | 59 | 2.9 |
8 CAG-OTS3/Cas+ | N701 | S508 | 13.6 | 59 | 4.3 |
9 CAG-OTS4/Cas- | N702 | S501 | 21 | 59 | 2.8 |
10 CAG-OTS4/Cas+ | N702 | S502 | 17.6 | 59 | 3.4 |
11 CAG-OTS5Cas- | N702 | S503 | 16.8 | 59 | 3.5 |
12 CAG-OTS5Cas+ | N702 | S504 | 15.2 | 59 | 3.9 |
13 CAG-OTS6/7Cas- | N702 | S505 | 23.2 | 59 | 2.5 |
14 CAG-OTS6/7Cas- | N702 | S506 | 19.6 | 59 | 3 |
15 CAG-OTS8Cas- | N702 | S507 | 20.8 | 59 | 2.8 |
16 CAG-OTS8Cas+ | N702 | S508 | 22.8 | 59 | 2.6 |
17 CAG-OTS9Cas- | N703 | S501 | 17.6 | 59 | 3.4 |
18 CAG-OTS9Cas+ | N703 | S502 | 19 | 59 | 3.1 |
19 CAG-OTS10Cas- | N703 | S503 | 17.4 | 59 | 3.4 |
20 CAG-OTS10Cas+ | N703 | S504 | 21.6 | 59 | 2.7 |
21 CAG-OTS11Cas- | N703 | S505 | 17 | 59 | 3.5 |
22 CAG-OTS11Cas+ | N703 | S506 | 16.9 | 59 | 3.5 |
23 CAG-OTS12Cas- | N703 | S507 | 17.2 | 59 | 3.4 |
24 CAG-OTS12Cas+ | N703 | S508 | 23.1 | 59 | 2.6 |
- data analysis
bwa mem -O 4 -R '@RG ID: SM:OTS PL:ILLUMINA LB:' /home/zhl002/genomeDB/mm9/Mm9.fasta $fastq->$sam
/home/kunzhang/softwares/samtools-latest/samtools view -b -t /home/zhl002/genomeDB/mm9/Mm9.fasta.fai $sam -> $bam
java -Xmx4g -jar /home/shg047/software/picard-tools-1.113/SortSam.jar TMP_DIR=./tmp/ INPUT=$bam OUTPUT=$.sorted.bam QUIET=True SORT_ORDER=coordinate VALIDATION_STRINGENCY=SILENT
/home/kunzhang/softwares/samtools-latest/samtools index $.sorted.bam
/home/zhl002/software/freebayes/bin/freebayes -f /home/zhl002/genomeDB/mm9/Mm9.fasta -F 0.0001 -C 2 --pooled-continuous --no-snps --targets OTS$.bed $.sorted.bam (for on-target bam file): -F 0.01 was used instead
GATK parameter used: java -Djava.io.tmpdir=./tmp -Xmx4g -jar /home/kunzhang/softwares/GenomeAnalysisTK-3.3/GenomeAnalysisTK.jar -T UnifiedGenotyper -L chr18 -R /home/zhl002/genomeDB/mm9/Mm9.fasta -I $.sorted.bam -glm INDEL -stand_call_conf 30 -stand_emit_conf 10 -o $.vcf
Calculate the in/del frequency: find alternative alleles identified at or close to the nuclease cutting site take the column with insertion/deletion/complex alternative allele being called (AO), then divide the total read count in the vcf generated (DP)
NOTES: On target samples were mapped to custom sequences that span the targeting sites Dr. Zhang repeated the analysis using script below: /home/kunzhang/softwares/bwa-0.7.10/bwa bwasw Ai14.fa CAGOnS1.fastq > CAGOnS1.bwasw.sam samtools import Ai14.fa.fai CAGOnS1.bwasw.sam CAGOnS1.bwasw.bam samtools sort CAGOnS1.bwasw.bam CAGOnS1.bwasw.sorted samtools index CAGOnS1.bwasw.sorted.bam /home/kunzhang/softwares/freebayes/bin/freebayes -f Ai14.fa -F 0.0001 -C 2 --pooled-continuous --target Ontarget.bed --no-snps CAGOnS1.bwasw.sorted.bam > CAGOnS1.bwasw.sorted.vcf
Results[edit]
# | chromosome | position | sequence | PAM | total read depth | # of indel (%) |
On | chr6 | GAGGAACTTCTTAGGGCCCGCGG | CGG | 717,296 | 4.2618 | |
OTS1 | chr13 | 9534141 | CAGGAACTTCTTAGGTCCCGTGG | TGG | 825,966 | 0.0115 |
OTS2 | chr14 | 85157555 | CGGAAACATCTTAGGGCCCGGGG | GGG | 455,049 | 0.0147 |
OTS3 | chr2 | 74925639 | GGAGTACTTCTTAGGGCCCACAG | CAG | 407,292 | 0.0152 |
OTS4 | chr15 | 69159526 | CAGGAACATATTAGGGCCCAGGG | GGG | 364,310 | 0.0159 |
OTS5 | chr12 | 100704049 | CAGGAACATGTTAGGGTCCGAGG | AGG | 980,881 | 0.0114 |
OTS6 | chrX | 91969928 | CAGGAACGTGTTCGGGCCCGCGG | CGG | 551,434 | 0 |
OTS7 | chrX | 92043584 | CAGGAACGTGTTCGGGCCCGCGG | CGG | 551,434 | 0 |
OTS8 | chr10 | 17440682 | CAGGAACTTCTTAGTGCCCTAAG | AAG | 524,379 | 0.0147 |
OTS9 | chr18 | 25702486 | GTGGACCTTTTCAGGGCCCGTGG | TGG | 575,965 | 0.0325 |
OTS10 | chr18 | 9212447 | GAGGCCCCTCTTCGGGCCCGGAG | GAG | 484,996 | 0.0115 |
OTS11 | chr14 | 46862821 | GTGGAGCATCTTAGGGCCAGTGG | TGG | 745,785 | 0.0126 |
OTS12 | chr12 | 31652981 | GAGCAACAACTTAGGGCCTGCAG | CAG | 352,693 | 0.0139 |
OLD results of first few rounds of pilot experiment[edit]
- 1st round primer design:
- post-Nextera 1st PCR:
- Kei-ValidSeq-F: ACATGGTCCTGCTGGAGTTC (Forward primer at end of GFP to detect the on/off target sequence after the knock-in site)
- kei-ValidSeq-R: GTTTACGTCGCCGTCCAG (Reverse primer at beginning of GFP to detect the on/off target sequence before the knock-in site)
- 2nd round primer design:
- NOTE: previous design wasn't good because Kei's sample relied on NHEJ to integrate transgene while H9CFP used HR; the integration site wasn't exactly next to the fluorescent proteins, NHEJ sample is next to the cutting site while HR sample is next to HR arms
- Kei-begGFP-R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTGAACTTGTGGCCGTTTA (Reverse primer at beginning of GFP to detect the on/off target sequence before the knock-in site)
- Nextera library construction on extracted gDNA of FACS sorted GFP-positive cells:
- TD (Tagment DNA Buffer)
- NT (Neutralize Tagment Buffer)
- ATM (Amplicon Tagment Mix)
- Input DNA (protocol recommend 0.2 ng/μl)
Sample: CRISPR mediated knock-in at Rosa26 transgenic mice(mCherry+) into non-dividing cells (injected into muscle cells) Kei sample 3 (~4500 cells): -Cas9 mCherry+ gDNA Kei sample 4 (~1500 cells): +Cas9 mCherry+ gDNA Kei sample 6 (~320 cells): +Cas9 GFP+ gDNA CFP-H9-BB (~7x10^5 cells) extracted DNA with Arcturus PicoPure DNA Extraction Kit provided by Kei (this kit can potentially used for very low cell#)
Tagmentation (Nextera XT Tagment Amplicon tube)
- Remove the ATM, TD, and input DNA from -25°C to -15°C storage and thaw on ice
- Visually inspect NT to make sure that there is no precipitate. If there is precipitate, vortex until all particulates are resuspended
- After thawing, mix reagents by gently inverting the tubes 3–5 times, followed by a brief spin in a microcentrifuge
- Add 2.5 μl TD Buffer to each well to be used in this assay
- Add 1.25 μl input DNA at 0.2 ng/μl (1 ng total)
- Add 1.25 μl ATM to the wells containing input DNA and TD Buffer.
- Centrifuge at 280 × g at 20°C for 1 minute.
- Place in a thermal cycler and run the following program: 55°C for 5 minutes -> Hold at 10°C
- When the sample reaches 10°C, proceed immediately to Neutralize samples as the transposome is still active and add 1.25 μl NT Buffer
- vortex at medium speed briefly
- Centrifuge at 280 × g at 20°C for 1 minute.
- Leave at room temperature for 5 minutes.
PCR amplification of tagmentation treated DNA
- add 1.25 μl index 2 primers (white caps)
- add 1.25 μl index 1 primers (orange caps)
- add 3.75 ul NPM (amplification mix)
- Centrifuge at 280 × g at 20°C for 1 minute.
- Perform PCR using the following program on a thermal cycler:
- 72°C for 3 minutes
- 95°C for 30 seconds
- 12 cycles of: 95°C for 10 seconds, 55°C for 30 seconds, 72°C for 30 seconds
- 72°C for 5 minutes
- Hold at 10°C
- Ampure bead XP purification with 1x concentration of bead, and elute in 10ul of H2O
2nd PCR amplification with custom primers
reaction setup (x4 samples): purified gDNA from above: 3ul Phusion MM: 25ul Syb_FP5 (forward primer, 10uM): 1ul kei-ValidSeq-R (reverse primer, 10um): 1ul H2O: 20ul
2nd reaction setup (x4 samples): purified gDNA from above: 3ul Phusion MM: 25ul Syb_RP7(reverse primer, 10uM): 1ul kei-ValidSeq-F (forward primer, 10um): 1ul H2O: 20ul
- 98°C for 30 seconds --> 28-35 cycles of: 98°C for 10 seconds, 60°C for 30 seconds, 72°C for 30 seconds --> 72°C for 3 minutes --> Hold at 10°C
- gel results:
File:ZhangLab 2 2015-10-26 16hr 13min-edit.jpg
- lane legend (left to right):
- LM ladder
- H9CFP-BB beginning of GFP
- Kei: +Cas9+mCherry beginning of GFP
- Kei: +Cas9+GFP beginning of GFP (30 cycles)
- Kei: -Cas9+mCherry beginning of GFP
- Kei: +Cas9+mCherry end of GFP
- Kei: +Cas9+GFP end of GFP (30 cycles)
- Kei: -Cas9+mCherry end of GFP
- Kei: +Cas9+GFP beginning of GFP (purify and ran 5 more cycles)
- Kei: +Cas9+GFP end of GFP (purify and ran 5 more cycles)
testing out different design of the PCR
- after nextera, use the fragmented gDNA as template to run locus specific PCR
- Kei-begGFP-R: (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)GCTGAACTTGTGGCCGTTTA
- (sequences) indicates illumina adaptor overhang
reaction setup (x3 samples): gDNA after nextera: 6.25 ul Kapa Hifi Readymix: 12.5ul custom reverse primer (10uM): 1ul F5 forward primer from Nextera: 1ul H2O: 4.25ul
- 95°C for 3 min --> 25 cycles of: 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds --> 72°C for 3 minutes --> Hold at 10°C
File:ZhangLab 2 2015-10-30 10hr 12min-edit.jpg
- lane legend (left to right)
- LM ladder
- Kei: +Cas9+mCherry beginning of GFP
- Kei: +Cas9+GFP beginning of GFP
- Kei: -Cas9+mCherry beginning of GFP
- purify the above PCR product with qiagen qiaquick kit and also Ampure bead
- then amplify again in 50ul reaction with the same condition as above
- gel results:
File:ZhangLab 2 2015-10-30 12hr 46min-edit.jpg
- LAM-PCR product library construction*
- Since the method above don't seem to work well, so maybe directly perform PCR with Illumina tail on genomic DNA is not the best way to go
- there could be multiple reasons that the above method didn't work: complex genome, PCR primer tail bring
- used new trial kit: NEBNext® Ultra™ II DNA Library Prep
- followed manufacture protocol
- sequencd in Miseq (~0.2 million reads total)