Kun:LabNotes/ExonomeSeq/2007-11-15

From ZhangLabWiki
Jump to navigation Jump to search

Design of padlock probes for the first proof-of-principle chip[edit]

  • I received two sets of PCR primers targeting 200bp and 400bp amplicons.
  • I will design padlock probes for both sets, then select a subset of 55k for the first chip. I will include both 200bp and 400bp probes for the genes in the Cosmic database. The remaining space on the chip will be used for the 200bp probes in chromosome 22, 21, 20, ... until the chip is full.
  • I will use the CircPlexV7 design for padlock probes. It is a modified version from V6. The only difference is that I added another Mme I site so that I can remove the linker sequences after exon capture if necessary. I've checked the secondary structure of the padlock probe with this new site, and found no major difference.
  • The way to convert PCR primers to padlock probe is:
    padlock probe = AP1 + revcomp(RP) + linker + LP + AP2
    AP1 = TTGGGTCATATCGGTCACTGTT
    AP2 = GATCAGGATACACACTACCCGTG
    Linker = GTTGGAGGCTCATCGTTCCTATTCAGCTGCAGATGTTATCGAGGTCCGAC
  • Here is the perl code for generating probes.