Rui:LabNotes/Haplotyping/2014-11-12

From ZhangLabWiki
Jump to navigation Jump to search

Oligo set 90k_oligos_30Sept2014[edit]

Basic information[edit]

*Sept14 probe set: Media:90k_oligos_30Sept2014.txt.gz
           probe set           # probes    Length             Amp primers                                               
  Chris    gDNA_MS_v2            8,045      127bp  V6(G*T*CATATCGGTCACTGTU//5Phos/GGGTAGTGTGTATCCTG)      
  Kun      cancer_hyb_sept14    51,639  110-130bp  V8(T*C*TAATCTAGCGCGACGTCU//5Phos/CCACAAGAGGCGCTATG)   
  Kun      LMS_selector         17,342  124-130bp  NE(TGCCTAGGACCGGATCAACT/GCTTCGGTTCACGCAATG)           
  Kun      padlock_SNPs         12,974      125bp  V4(G*A*CTGGAAGAGCACTGTU//5Phos/AGCCTCATGCGTATCCG)    **has mismatch with Noi's V4??     
                         Total  90,000
Oligo calculation for ePCR Content Unit '
gram-conc. (Tube concentration) 48.43 ng/ul
Tube volume 80 ul
Total amount 3874.4 ng
Oligo average length 125 nt * The average size for all probes in this pool
MW (Length*330 Da/bp) 41250 Da (g/mole)
Mole-conc. (gram-conc / MW * 1000) 1.174060606 uM
              Set frac.   Cor.nM	Amp. Primers    quick-Run(Ct up)
Oligo set 1 	0.09	   104.95	V6               15      
Oligo set 2	0.57	   673.64	V8                7
Oligo set 3	0.19	   226.23	NE               11
Oligo set 4	0.14	   169.25	V4               14

Expansion PCR[edit]

Quick run with 1ul for each primer set[edit]

Tube ID Sample [nM] [ul] AmpP Ct up Ct stop final Flu.
s1 T21.v4 ePCR 361 0.5 v4 ** 1 6 0.32
s2 oligo mix ~ 169 1 v4 ** 13 20 ~0.2
s3 T21.v6 ePCR 181 1 v6 1 7 0.28
s4 oligo mix ~105 1 v6 15 20 ~0.13
s5 selector ePCR 150 1 eMIP no 20 no
s6 oligo mix ~226 1 eMIP no 20 no


File:EPCR QPCR.jpgFile:EPCR PAGE.jpg

Recheck with eMIP primer sets[edit]

  • Positive control used is the pPCR product (65nM is confirmed by Nanodrop again) of selector set last time
  • Probe/primer were also confirmed with PAGE together with PCR product
  • The problem may be due to eMIP primer set -> re-order

File:QuickRun eMIP QPCR.jpgFile:QuickRun eMIP PAGE.jpg

  • Fortunately, I found another eMIP pair from my box, so I gave this set a try with PC used above.
  • It works as expected, so I toss the bad primers originally in Noi's box.

File:EPCR eMIP QPCR.jpgFile:EPCR v4.jpgFile:QuickRun PAGE.jpgFile:EPCR eMIP.jpg

Production PCR for 3 oligo sets 2-4 (v4,v8,eMIP)[edit]

File:PPCR v4 QPCR.jpgFile:PPCR v3 QPCR.jpg